Starting /dee2/code/volunteer_pipeline.sh SRR5423313 current disk space = 3050543734784 free memory = 1519946276 SRR5423313 SRAfilesize bb24e2fdd94a0da313ef5ff29f3b4c02 SRR5423313.sra SRR5423313.sra file validated SRR5423313 is single end SRR5423313 is conventional basespace SRR5423313 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423313_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49325 34.0 31.0 34.0 31.0 34.0 2 32.4895 34.0 31.0 34.0 30.0 34.0 3 32.591 34.0 31.0 34.0 30.0 34.0 4 35.95575 37.0 35.0 37.0 35.0 37.0 5 36.03175 37.0 35.0 37.0 35.0 37.0 6 35.93225 37.0 35.0 37.0 35.0 37.0 7 35.97375 37.0 35.0 37.0 35.0 37.0 8 35.96425 37.0 35.0 37.0 35.0 37.0 9 37.68275 39.0 37.0 39.0 35.0 39.0 10 37.68625 39.0 37.0 39.0 35.0 39.0 11 37.6435 39.0 37.0 39.0 35.0 39.0 12 37.55025 39.0 37.0 39.0 35.0 39.0 13 37.5095 39.0 37.0 39.0 35.0 39.0 14 39.035 40.0 38.0 41.0 36.0 41.0 15 39.0675 40.0 38.0 41.0 36.0 41.0 16 38.7865 40.0 38.0 41.0 35.0 41.0 17 38.82525 40.0 38.0 41.0 35.0 41.0 18 38.79025 40.0 38.0 41.0 35.0 41.0 19 38.94625 40.0 38.0 41.0 35.0 41.0 20 38.86125 40.0 38.0 41.0 35.0 41.0 21 38.87575 40.0 38.0 41.0 35.0 41.0 22 38.857 40.0 38.0 41.0 35.0 41.0 23 38.67075 40.0 38.0 41.0 34.0 41.0 24 38.7325 40.0 38.0 41.0 35.0 41.0 25 38.6585 40.0 38.0 41.0 34.0 41.0 26 38.4845 40.0 38.0 41.0 34.0 41.0 27 38.52 40.0 38.0 41.0 34.0 41.0 28 38.4865 40.0 38.0 41.0 34.0 41.0 29 38.43 40.0 38.0 41.0 34.0 41.0 30 38.23675 40.0 38.0 41.0 34.0 41.0 31 38.174 40.0 38.0 41.0 33.0 41.0 32 37.957 40.0 38.0 41.0 33.0 41.0 33 37.9405 40.0 38.0 41.0 33.0 41.0 34 37.84225 40.0 38.0 41.0 33.0 41.0 35 37.8465 40.0 38.0 41.0 33.0 41.0 36 37.60775 40.0 37.0 41.0 32.0 41.0 37 37.5795 40.0 37.0 41.0 31.0 41.0 38 37.6075 40.0 37.0 41.0 32.0 41.0 39 37.5575 40.0 37.0 41.0 32.0 41.0 40 37.236 40.0 36.0 41.0 30.0 41.0 41 37.13725 40.0 37.0 41.0 30.0 41.0 42 37.126 40.0 37.0 41.0 30.0 41.0 43 37.1705 40.0 36.0 41.0 30.0 41.0 44 37.17625 40.0 36.0 41.0 31.0 41.0 45 37.03075 40.0 36.0 41.0 30.0 41.0 46 36.939 40.0 36.0 41.0 30.0 41.0 47 36.715 39.0 35.0 41.0 30.0 41.0 48 36.64875 39.0 35.0 41.0 29.0 41.0 49 36.65475 39.0 35.0 41.0 29.0 41.0 50 36.71 39.0 35.0 41.0 30.0 41.0 51 36.28875 39.0 35.0 41.0 28.0 41.0 52 34.6825 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2102 1 0.0 2102 2 0.0 2102 3 0.0 2102 4 0.0 2102 5 0.0 2102 6 0.0 2102 7 0.0 2102 8 0.0 2102 9 0.0 2102 10 0.0 2102 11 0.0 2102 12 0.0 2102 13 0.0 2102 14 0.0 2102 15 0.0 2102 16 0.0 2102 17 0.0 2102 18 0.0 2102 19 0.0 2102 20 0.0 2102 21 0.0 2102 22 0.0 2102 23 0.0 2102 24 0.0 2102 25 0.0 2102 26 0.0 2102 27 0.0 2102 28 0.0 2102 29 0.0 2102 30 0.0 2102 31 0.0 2102 32 0.0 2102 33 0.0 2102 34 0.0 2102 35 0.0 2102 36 0.0 2102 37 0.0 2102 38 0.0 2102 39 0.0 2102 40 0.0 2102 41 0.0 2102 42 0.0 2102 43 0.0 2102 44 0.0 2102 45 0.0 2102 46 0.0 2102 47 0.0 2102 48 0.0 2102 49 0.0 2102 50 0.0 2102 51 0.0 2102 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 2.0 21 3.0 22 3.0 23 13.0 24 11.0 25 13.0 26 12.0 27 27.0 28 34.0 29 46.0 30 76.0 31 74.0 32 90.0 33 133.0 34 141.0 35 216.0 36 293.0 37 409.0 38 715.0 39 1678.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.831663326653306 10.97194388777555 5.661322645290581 42.53507014028056 2 23.425 13.4 35.925000000000004 27.250000000000004 3 21.6 16.625 24.95 36.825 4 25.45 25.724999999999998 21.0 27.825 5 24.8 30.8 23.05 21.349999999999998 6 20.1 31.474999999999998 25.974999999999998 22.45 7 15.675 22.15 42.199999999999996 19.975 8 17.65 21.775 31.05 29.525000000000002 9 19.35 20.025000000000002 34.150000000000006 26.474999999999998 10 19.375 36.075 24.099999999999998 20.45 11 24.75 24.8 21.725 28.725 12 21.4 23.799999999999997 26.650000000000002 28.15 13 20.075000000000003 26.75 28.275 24.9 14 21.5 25.874999999999996 27.05 25.575 15 21.875 25.525 27.6 25.0 16 20.849999999999998 25.15 26.724999999999998 27.275 17 23.325000000000003 26.200000000000003 26.474999999999998 24.0 18 21.775 25.575 26.75 25.900000000000002 19 21.9 26.625 24.875 26.6 20 21.5 26.125 26.650000000000002 25.724999999999998 21 21.825 25.75 25.6 26.825 22 22.25 26.924999999999997 24.5 26.325 23 23.25 26.35 25.4 25.0 24 23.325000000000003 25.124999999999996 25.224999999999998 26.325 25 22.075 26.775 25.674999999999997 25.474999999999998 26 22.775000000000002 26.150000000000002 25.074999999999996 26.0 27 22.400000000000002 25.35 26.424999999999997 25.825 28 23.125 25.174999999999997 26.450000000000003 25.25 29 21.95 25.4 26.275 26.375 30 21.9 26.424999999999997 26.424999999999997 25.25 31 22.275 26.424999999999997 24.65 26.650000000000002 32 22.7 25.900000000000002 25.724999999999998 25.674999999999997 33 22.6 24.4 26.625 26.375 34 21.725 24.975 26.674999999999997 26.625 35 21.775 25.1 26.0 27.125 36 21.075 26.474999999999998 26.025 26.424999999999997 37 22.55 25.1 25.724999999999998 26.625 38 22.8 25.724999999999998 24.825 26.650000000000002 39 22.5 25.724999999999998 24.4 27.375 40 22.05 25.775 25.825 26.35 41 22.125 25.575 24.975 27.325 42 22.5 23.875 25.874999999999996 27.750000000000004 43 22.325 25.05 25.85 26.775 44 23.05 25.124999999999996 26.075 25.75 45 23.625 23.45 25.7 27.224999999999998 46 22.625 25.5 25.025 26.85 47 23.474999999999998 25.3 24.4 26.825 48 22.55 26.474999999999998 25.5 25.474999999999998 49 22.975 26.3 24.7 26.025 50 23.3 25.55 25.6 25.55 51 23.35 24.375 26.650000000000002 25.624999999999996 52 23.0 26.325 25.074999999999996 25.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 3.5 19 4.0 20 3.0 21 2.0 22 3.0 23 4.0 24 9.5 25 15.0 26 15.0 27 15.0 28 20.5 29 26.0 30 39.0 31 52.0 32 58.5 33 65.0 34 83.5 35 102.0 36 118.0 37 134.0 38 156.5 39 201.5 40 224.0 41 239.0 42 254.0 43 270.0 44 286.0 45 298.0 46 310.0 47 327.0 48 344.0 49 344.0 50 344.0 51 335.5 52 327.0 53 315.0 54 303.0 55 265.5 56 228.0 57 224.0 58 220.0 59 193.0 60 166.0 61 143.0 62 120.0 63 93.5 64 64.0 65 61.0 66 53.0 67 45.0 68 35.0 69 25.0 70 25.0 71 25.0 72 20.5 73 16.0 74 12.0 75 8.0 76 9.0 77 10.0 78 6.5 79 3.0 80 2.5 81 2.0 82 3.0 83 4.0 84 2.0 85 0.0 86 0.5 87 1.0 88 1.0 89 1.0 90 1.0 91 1.5 92 2.0 93 1.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.72909522553415 91.675 2 2.1366394091268797 4.05 3 0.6594566077552098 1.875 4 0.21102611448166714 0.8 5 0.10551305724083357 0.5 6 0.052756528620416784 0.3 7 0.052756528620416784 0.35000000000000003 8 0.026378264310208392 0.2 9 0.0 0.0 >10 0.026378264310208392 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 10 0.25 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 8 0.2 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 7 0.17500000000000002 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 6 0.15 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 6 0.15 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTC 5 0.125 No Hit GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 5 0.125 No Hit GCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra Read 200000 spots for SRR5423313.sra Written 200000 spots for SRR5423313.sra SRR ids: ['SRR5423313.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tmuqgxwx SRR5423313.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423313 file size 703960 SRR5423313 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423313 SRR5423313_1.fastq Input file: SRR5423313_1.fastq trimmed: SRR5423313-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:52:37 2025 >> started Wed Feb 12 21:52:39 2025 >> done (1.941s) 4000000 reads processed; of these: 147 ( 0.00%) short reads filtered out after trimming by size control 60 ( 0.00%) empty reads filtered out after trimming by size control 3999793 (99.99%) reads available; of these: 92356 ( 2.31%) trimmed reads available after processing 3907437 (97.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 11 0.00% 25 4 0.00% 26 10 0.00% 27 13 0.00% 28 16 0.00% 29 7 0.00% 30 13 0.00% 31 17 0.00% 32 26 0.00% 33 30 0.00% 34 39 0.00% 35 51 0.00% 36 76 0.00% 37 72 0.00% 38 84 0.00% 39 124 0.00% 40 164 0.00% 41 200 0.01% 42 281 0.01% 43 298 0.01% 44 555 0.01% 45 762 0.02% 46 947 0.02% 47 1354 0.03% 48 2215 0.06% 49 4654 0.12% 50 11733 0.29% 51 68582 1.71% 52 3907437 97.69% 3999793 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=24.74 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:52:52 Started mapping on | Feb 12 21:52:52 Finished on | Feb 12 21:52:59 Mapping speed, Million of reads per hour | 2057.04 Number of input reads | 3999793 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3306360 Uniquely mapped reads % | 82.66% Average mapped length | 51.77 Number of splices: Total | 318562 Number of splices: Annotated (sjdb) | 314156 Number of splices: GT/AG | 311228 Number of splices: GC/AG | 5726 Number of splices: AT/AC | 533 Number of splices: Non-canonical | 1075 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462045 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 124208 % of reads mapped to too many loci | 3.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231388 231388 231388 N_multimapping 462045 462045 462045 N_noFeature 618280 3235204 677614 N_ambiguous 25095 200 13086 UnstrandedReadsAssigned:2662985 PositiveStrandReadsAssigned:70956 NegativeStrandReadsAssigned:2615660 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423313 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423313-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,793 reads, 2,972,677 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR5423313.ke.tsv 34699 SRR5423313.se.tsv 87100 total ==> SRR5423313.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 79 14.2171 Potri.005G024800.1.v4.1 1035 936 1 0.368964 Potri.004G059700.1.v4.1 961 862 3 1.20191 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 65.7729 7.98687 Potri.016G087400.1.v4.1 270 171 22.5902 45.623 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 30 11.8001 ==> SRR5423313.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 49 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423313 completed mapping pipeline successfully