Starting /dee2/code/volunteer_pipeline.sh SRR5423314 current disk space = 3050303037440 free memory = 1578691056 SRR5423314 SRAfilesize ea80f0aece9619f47484259b7122ba46 SRR5423314.sra SRR5423314.sra file validated SRR5423314 is single end SRR5423314 is conventional basespace SRR5423314 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423314_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.566 31.0 31.0 34.0 30.0 34.0 2 31.80125 31.0 31.0 34.0 30.0 34.0 3 31.90975 33.0 31.0 34.0 30.0 34.0 4 34.95825 37.0 35.0 37.0 32.0 37.0 5 35.3135 37.0 35.0 37.0 32.0 37.0 6 35.35875 37.0 35.0 37.0 32.0 37.0 7 35.43325 37.0 35.0 37.0 33.0 37.0 8 35.64775 37.0 35.0 37.0 33.0 37.0 9 36.91875 39.0 37.0 39.0 32.0 39.0 10 37.0875 39.0 37.0 39.0 33.0 39.0 11 37.1775 39.0 37.0 39.0 33.0 39.0 12 37.23475 39.0 37.0 39.0 34.0 39.0 13 37.0795 39.0 37.0 39.0 33.0 39.0 14 38.43125 40.0 38.0 41.0 33.0 41.0 15 38.36425 40.0 38.0 41.0 34.0 41.0 16 38.18375 40.0 37.0 41.0 33.0 41.0 17 38.2065 40.0 37.0 41.0 33.0 41.0 18 38.3455 40.0 38.0 41.0 33.0 41.0 19 38.4685 40.0 38.0 41.0 34.0 41.0 20 38.3145 40.0 38.0 41.0 34.0 41.0 21 38.23175 40.0 38.0 41.0 33.0 41.0 22 38.22025 40.0 38.0 41.0 33.0 41.0 23 38.173 40.0 38.0 41.0 33.0 41.0 24 38.229 40.0 38.0 41.0 33.0 41.0 25 38.3085 40.0 38.0 41.0 33.0 41.0 26 38.17625 40.0 38.0 41.0 33.0 41.0 27 38.00375 40.0 37.0 41.0 33.0 41.0 28 37.942 40.0 37.0 41.0 33.0 41.0 29 38.01175 40.0 37.0 41.0 33.0 41.0 30 37.89275 40.0 37.0 41.0 33.0 41.0 31 37.94225 40.0 37.0 41.0 33.0 41.0 32 37.93125 40.0 37.0 41.0 33.0 41.0 33 37.544 40.0 37.0 41.0 32.0 41.0 34 37.63275 40.0 37.0 41.0 32.0 41.0 35 37.63 40.0 37.0 41.0 32.0 41.0 36 37.506 40.0 37.0 41.0 31.0 41.0 37 37.6545 40.0 37.0 41.0 33.0 41.0 38 37.46275 40.0 37.0 41.0 31.0 41.0 39 37.18225 39.0 36.0 41.0 31.0 41.0 40 36.944 39.0 36.0 41.0 30.0 41.0 41 37.0765 39.0 36.0 41.0 30.0 41.0 42 37.156 39.0 36.0 41.0 31.0 41.0 43 37.298 39.0 36.0 41.0 31.0 41.0 44 37.02 39.0 36.0 41.0 30.0 41.0 45 36.8575 39.0 35.0 41.0 30.0 41.0 46 36.82675 39.0 35.0 41.0 30.0 41.0 47 36.77425 39.0 35.0 41.0 30.0 41.0 48 36.7585 39.0 35.0 40.0 30.0 41.0 49 36.36925 39.0 35.0 40.0 30.0 41.0 50 36.6455 39.0 35.0 41.0 30.0 41.0 51 36.5 39.0 35.0 40.0 30.0 41.0 52 34.69025 37.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 3.0 23 4.0 24 7.0 25 15.0 26 14.0 27 24.0 28 40.0 29 64.0 30 69.0 31 88.0 32 136.0 33 159.0 34 204.0 35 286.0 36 363.0 37 461.0 38 721.0 39 1331.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.49586776859504 11.269722013523667 5.785123966942149 42.449286250939146 2 23.724999999999998 13.975000000000001 35.8 26.5 3 21.45 17.150000000000002 23.799999999999997 37.6 4 25.775 25.424999999999997 21.2 27.6 5 24.775 31.324999999999996 23.799999999999997 20.1 6 19.175 32.6 24.525 23.7 7 15.7 22.825 42.699999999999996 18.775 8 18.099999999999998 22.125 31.525 28.249999999999996 9 19.475 20.349999999999998 33.475 26.700000000000003 10 19.5 36.725 24.85 18.925 11 24.099999999999998 26.224999999999998 21.8 27.875 12 22.2 23.05 26.775 27.975 13 19.775000000000002 28.65 28.225 23.35 14 22.075 27.275 25.124999999999996 25.525 15 20.875 26.900000000000002 26.450000000000003 25.775 16 20.474999999999998 26.375 27.0 26.150000000000002 17 22.45 25.75 26.200000000000003 25.6 18 21.099999999999998 26.400000000000002 26.875 25.624999999999996 19 22.475 26.8 24.474999999999998 26.25 20 21.725 25.074999999999996 27.525 25.674999999999997 21 21.95 25.650000000000002 26.200000000000003 26.200000000000003 22 21.25 27.075 25.025 26.650000000000002 23 21.9 27.500000000000004 24.349999999999998 26.25 24 21.575 25.75 26.450000000000003 26.224999999999998 25 22.475 25.650000000000002 25.924999999999997 25.95 26 22.45 24.825 26.825 25.900000000000002 27 21.95 25.55 26.1 26.400000000000002 28 22.125 25.575 26.924999999999997 25.374999999999996 29 23.200000000000003 25.2 27.250000000000004 24.349999999999998 30 20.724999999999998 24.925 26.8 27.55 31 20.625 27.375 25.974999999999998 26.025 32 21.8 26.025 27.325 24.85 33 22.375 25.0 25.825 26.8 34 20.150000000000002 26.400000000000002 26.625 26.825 35 22.25 26.200000000000003 24.8 26.75 36 20.625 26.625 25.0 27.750000000000004 37 22.1 25.874999999999996 25.8 26.224999999999998 38 21.5 26.525 24.775 27.200000000000003 39 21.625 24.6 27.35 26.424999999999997 40 22.475 26.424999999999997 26.8 24.3 41 22.7 26.125 24.25 26.924999999999997 42 21.224999999999998 24.575 26.025 28.175 43 23.549999999999997 24.7 24.625 27.125 44 21.675 25.424999999999997 25.825 27.075 45 22.900000000000002 25.374999999999996 25.25 26.474999999999998 46 22.975 24.474999999999998 24.7 27.85 47 23.799999999999997 25.0 24.8 26.400000000000002 48 23.0 24.325 26.35 26.325 49 22.525000000000002 26.025 25.324999999999996 26.125 50 23.05 26.275 25.5 25.174999999999997 51 23.275000000000002 25.45 24.525 26.75 52 23.275000000000002 26.775 24.575 25.374999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 3.0 16 3.0 17 3.0 18 4.0 19 5.0 20 6.5 21 8.0 22 10.0 23 12.0 24 10.5 25 9.0 26 16.0 27 23.0 28 31.5 29 40.0 30 47.0 31 54.0 32 67.0 33 80.0 34 87.5 35 95.0 36 111.0 37 127.0 38 154.5 39 197.5 40 213.0 41 236.0 42 259.0 43 284.0 44 309.0 45 311.0 46 313.0 47 315.0 48 317.0 49 330.0 50 343.0 51 323.5 52 304.0 53 307.0 54 310.0 55 275.5 56 241.0 57 214.5 58 188.0 59 172.5 60 157.0 61 142.0 62 127.0 63 102.5 64 75.0 65 72.0 66 62.0 67 52.0 68 38.0 69 24.0 70 18.0 71 12.0 72 13.5 73 15.0 74 12.0 75 9.0 76 7.0 77 5.0 78 4.5 79 4.0 80 3.0 81 2.0 82 1.5 83 1.0 84 1.5 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 96.7208814270724 92.175 2 2.2822665267576077 4.35 3 0.5508919202518363 1.575 4 0.26232948583420773 1.0 5 0.15739769150052466 0.75 6 0.026232948583420776 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGG 6 0.15 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra Read 200000 spots for SRR5423314.sra Written 200000 spots for SRR5423314.sra SRR ids: ['SRR5423314.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h3ixg_wf SRR5423314.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423314 file size 704028 SRR5423314 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423314 SRR5423314_1.fastq Input file: SRR5423314_1.fastq trimmed: SRR5423314-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:36:55 2025 >> started Wed Feb 12 06:36:57 2025 >> done (1.899s) 4000000 reads processed; of these: 121 ( 0.00%) short reads filtered out after trimming by size control 69 ( 0.00%) empty reads filtered out after trimming by size control 3999810 (100.00%) reads available; of these: 89666 ( 2.24%) trimmed reads available after processing 3910144 (97.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 8 0.00% 31 4 0.00% 32 18 0.00% 33 12 0.00% 34 22 0.00% 35 34 0.00% 36 36 0.00% 37 38 0.00% 38 45 0.00% 39 67 0.00% 40 65 0.00% 41 102 0.00% 42 144 0.00% 43 151 0.00% 44 243 0.01% 45 374 0.01% 46 496 0.01% 47 812 0.02% 48 1489 0.04% 49 3612 0.09% 50 11086 0.28% 51 70771 1.77% 52 3910144 97.76% 3999810 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=25.05 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 06:37:11 Started mapping on | Feb 12 06:37:11 Finished on | Feb 12 06:37:20 Mapping speed, Million of reads per hour | 1599.92 Number of input reads | 3999810 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3300101 Uniquely mapped reads % | 82.51% Average mapped length | 51.77 Number of splices: Total | 316243 Number of splices: Annotated (sjdb) | 311966 Number of splices: GT/AG | 309146 Number of splices: GC/AG | 5632 Number of splices: AT/AC | 503 Number of splices: Non-canonical | 962 Mismatch rate per base, % | 0.66% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463851 % of reads mapped to multiple loci | 11.60% Number of reads mapped to too many loci | 126281 % of reads mapped to too many loci | 3.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235858 235858 235858 N_multimapping 463851 463851 463851 N_noFeature 618590 3230642 676331 N_ambiguous 24820 199 12911 UnstrandedReadsAssigned:2656691 PositiveStrandReadsAssigned:69260 NegativeStrandReadsAssigned:2610859 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423314 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423314-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,810 reads, 2,918,262 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52401 SRR5423314.ke.tsv 34699 SRR5423314.se.tsv 87100 total ==> SRR5423314.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 74 13.642 Potri.005G024800.1.v4.1 1035 936 3 1.13388 Potri.004G059700.1.v4.1 961 862 4 1.64163 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 66.0823 8.2201 Potri.016G087400.1.v4.1 270 171 27 55.8586 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.211333 Potri.012G127500.1.v4.1 977 878 33 13.2966 ==> SRR5423314.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423314 completed mapping pipeline successfully