Starting /dee2/code/volunteer_pipeline.sh SRR5423315 current disk space = 3050308632576 free memory = 1579193708 SRR5423315 SRAfilesize 2babb492e0907804faae2bf1e59df55a SRR5423315.sra SRR5423315.sra file validated SRR5423315 is single end SRR5423315 is conventional basespace SRR5423315 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82575 33.0 31.0 34.0 30.0 34.0 2 31.93 33.0 31.0 34.0 30.0 34.0 3 32.04575 34.0 31.0 34.0 30.0 34.0 4 35.44175 37.0 35.0 37.0 33.0 37.0 5 35.54575 37.0 35.0 37.0 33.0 37.0 6 35.5525 37.0 35.0 37.0 33.0 37.0 7 35.577 37.0 35.0 37.0 33.0 37.0 8 35.723 37.0 35.0 37.0 33.0 37.0 9 37.3865 39.0 37.0 39.0 34.0 39.0 10 37.2025 39.0 37.0 39.0 33.0 39.0 11 37.26275 39.0 37.0 39.0 33.0 39.0 12 37.0715 39.0 37.0 39.0 33.0 39.0 13 37.141 39.0 37.0 39.0 33.0 39.0 14 38.3685 40.0 38.0 41.0 33.0 41.0 15 38.44725 40.0 38.0 41.0 33.0 41.0 16 38.408 40.0 38.0 41.0 34.0 41.0 17 38.41175 40.0 38.0 41.0 34.0 41.0 18 38.366 40.0 38.0 41.0 34.0 41.0 19 38.38625 40.0 38.0 41.0 34.0 41.0 20 38.37475 40.0 38.0 41.0 34.0 41.0 21 38.325 40.0 38.0 41.0 34.0 41.0 22 38.26575 40.0 38.0 41.0 34.0 41.0 23 38.28075 40.0 38.0 41.0 33.0 41.0 24 38.235 40.0 38.0 41.0 33.0 41.0 25 38.27275 40.0 38.0 41.0 33.0 41.0 26 38.2475 40.0 38.0 41.0 34.0 41.0 27 38.25775 40.0 38.0 41.0 33.0 41.0 28 38.2325 40.0 38.0 41.0 34.0 41.0 29 38.1445 40.0 37.0 41.0 33.0 41.0 30 38.07575 40.0 38.0 41.0 33.0 41.0 31 38.099 40.0 38.0 41.0 33.0 41.0 32 38.05325 40.0 37.0 41.0 33.0 41.0 33 37.73625 40.0 37.0 41.0 32.0 41.0 34 37.81025 40.0 37.0 41.0 33.0 41.0 35 37.62225 40.0 37.0 41.0 32.0 41.0 36 37.54625 40.0 37.0 41.0 31.0 41.0 37 37.48425 40.0 37.0 41.0 31.0 41.0 38 37.64825 40.0 37.0 41.0 31.0 41.0 39 37.64675 40.0 37.0 41.0 32.0 41.0 40 37.535 40.0 37.0 41.0 31.0 41.0 41 37.4885 40.0 36.0 41.0 31.0 41.0 42 37.3125 39.0 36.0 41.0 31.0 41.0 43 37.20325 39.0 36.0 41.0 31.0 41.0 44 37.28975 40.0 36.0 41.0 31.0 41.0 45 37.122 39.0 36.0 41.0 31.0 41.0 46 37.10975 39.0 36.0 41.0 30.0 41.0 47 37.112 39.0 36.0 41.0 31.0 41.0 48 36.93625 39.0 36.0 41.0 30.0 41.0 49 36.79425 39.0 35.0 41.0 30.0 41.0 50 36.79125 39.0 35.0 41.0 30.0 41.0 51 36.485 39.0 35.0 41.0 30.0 41.0 52 35.79125 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2110 1 0.0 2110 2 0.0 2110 3 0.0 2110 4 0.0 2110 5 0.0 2110 6 0.0 2110 7 0.0 2110 8 0.0 2110 9 0.0 2110 10 0.0 2110 11 0.0 2110 12 0.0 2110 13 0.0 2110 14 0.0 2110 15 0.0 2110 16 0.0 2110 17 0.0 2110 18 0.0 2110 19 0.0 2110 20 0.0 2110 21 0.0 2110 22 0.0 2110 23 0.0 2110 24 0.0 2110 25 0.0 2110 26 0.0 2110 27 0.0 2110 28 0.0 2110 29 0.0 2110 30 0.0 2110 31 0.0 2110 32 0.0 2110 33 0.0 2110 34 0.0 2110 35 0.0 2110 36 0.0 2110 37 0.0 2110 38 0.0 2110 39 0.0 2110 40 0.0 2110 41 0.0 2110 42 0.0 2110 43 0.0 2110 44 0.0 2110 45 0.0 2110 46 0.0 2110 47 0.0 2110 48 0.0 2110 49 0.0 2110 50 0.0 2110 51 0.0 2110 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 4.0 24 13.0 25 11.0 26 13.0 27 23.0 28 41.0 29 62.0 30 58.0 31 87.0 32 122.0 33 142.0 34 183.0 35 267.0 36 302.0 37 453.0 38 768.0 39 1443.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.423028785982474 10.137672090112641 5.88235294117647 45.55694618272841 2 23.724999999999998 14.575 34.625 27.075 3 21.2 18.375 23.375 37.05 4 24.575 26.55 22.0 26.875 5 25.0 29.775000000000002 24.9 20.325 6 19.475 32.375 24.775 23.375 7 15.024999999999999 22.45 41.525 21.0 8 17.675 21.2 31.45 29.675 9 18.35 21.725 33.975 25.95 10 19.25 37.5 23.1 20.150000000000002 11 22.975 26.474999999999998 22.075 28.475 12 23.275000000000002 23.5 25.275 27.950000000000003 13 19.875 27.450000000000003 28.425 24.25 14 21.55 26.724999999999998 27.825 23.9 15 20.599999999999998 26.775 26.174999999999997 26.450000000000003 16 20.9 26.450000000000003 26.275 26.375 17 21.075 26.400000000000002 26.450000000000003 26.075 18 21.775 25.674999999999997 26.05 26.5 19 21.85 26.8 26.275 25.074999999999996 20 20.9 27.05 26.625 25.424999999999997 21 21.25 27.125 25.5 26.125 22 22.15 28.475 24.85 24.525 23 22.85 26.3 24.8 26.05 24 22.6 24.425 26.900000000000002 26.075 25 20.875 25.75 26.825 26.55 26 23.1 24.925 26.575 25.4 27 22.2 26.025 25.650000000000002 26.125 28 21.7 27.250000000000004 25.775 25.275 29 22.400000000000002 26.700000000000003 26.275 24.625 30 21.825 25.874999999999996 26.174999999999997 26.125 31 21.25 26.125 26.900000000000002 25.724999999999998 32 22.075 26.924999999999997 25.374999999999996 25.624999999999996 33 22.875 25.525 24.6 27.0 34 21.9 26.525 26.625 24.95 35 22.025 25.35 25.55 27.075 36 21.5 25.624999999999996 25.0 27.875 37 21.475 26.474999999999998 25.275 26.775 38 22.45 26.325 25.275 25.95 39 23.1 24.625 25.874999999999996 26.400000000000002 40 21.875 26.55 25.974999999999998 25.6 41 21.8 25.05 26.875 26.275 42 22.125 24.2 26.174999999999997 27.500000000000004 43 22.15 26.150000000000002 25.2 26.5 44 22.400000000000002 26.3 26.525 24.775 45 21.925 23.849999999999998 26.575 27.650000000000002 46 22.625 25.2 26.474999999999998 25.7 47 23.175 25.624999999999996 24.85 26.35 48 23.400000000000002 25.75 25.4 25.45 49 22.275 25.85 25.775 26.1 50 22.8 26.375 25.8 25.025 51 22.75 25.5 25.650000000000002 26.1 52 21.9 25.825 25.624999999999996 26.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 2.0 11 1.0 12 0.0 13 0.5 14 3.0 15 5.0 16 4.0 17 3.0 18 2.5 19 2.0 20 4.0 21 6.0 22 7.5 23 9.0 24 13.5 25 18.0 26 19.0 27 20.0 28 26.5 29 33.0 30 40.0 31 47.0 32 59.5 33 72.0 34 88.0 35 104.0 36 123.0 37 142.0 38 151.0 39 201.5 40 243.0 41 252.5 42 262.0 43 290.5 44 319.0 45 302.5 46 286.0 47 300.5 48 315.0 49 318.5 50 322.0 51 332.5 52 343.0 53 327.5 54 312.0 55 273.5 56 235.0 57 230.0 58 225.0 59 189.0 60 153.0 61 131.5 62 110.0 63 94.0 64 69.0 65 60.0 66 56.5 67 53.0 68 39.5 69 26.0 70 19.0 71 12.0 72 9.0 73 6.0 74 4.5 75 3.0 76 4.5 77 6.0 78 4.0 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.26786659608258 90.925 2 2.567496029645315 4.8500000000000005 3 0.7146638433033351 2.025 4 0.18528321863419797 0.7000000000000001 5 0.07940709370037057 0.375 6 0.1323451561672843 0.75 7 0.02646903123345686 0.17500000000000002 8 0.02646903123345686 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 8 0.2 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 7 0.17500000000000002 No Hit GTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAAC 6 0.15 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 6 0.15 No Hit GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 6 0.15 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit CTTTAGATAACAAAAAGTGGGAGCCCCGTCAGGTCGCCAAACTACGACGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra Read 200000 spots for SRR5423315.sra Written 200000 spots for SRR5423315.sra SRR ids: ['SRR5423315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_saombuq2 SRR5423315.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423315 file size 704022 SRR5423315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423315 SRR5423315_1.fastq Input file: SRR5423315_1.fastq trimmed: SRR5423315-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:46:32 2025 >> started Wed Feb 12 06:46:34 2025 >> done (1.903s) 4000000 reads processed; of these: 136 ( 0.00%) short reads filtered out after trimming by size control 76 ( 0.00%) empty reads filtered out after trimming by size control 3999788 (99.99%) reads available; of these: 88740 ( 2.22%) trimmed reads available after processing 3911048 (97.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 4 0.00% 25 9 0.00% 26 4 0.00% 27 1 0.00% 28 6 0.00% 29 4 0.00% 30 7 0.00% 31 10 0.00% 32 25 0.00% 33 26 0.00% 34 38 0.00% 35 34 0.00% 36 48 0.00% 37 46 0.00% 38 49 0.00% 39 94 0.00% 40 95 0.00% 41 133 0.00% 42 186 0.00% 43 214 0.01% 44 368 0.01% 45 444 0.01% 46 610 0.02% 47 1073 0.03% 48 1817 0.05% 49 3982 0.10% 50 11403 0.29% 51 67995 1.70% 52 3911048 97.78% 3999788 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.28 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 06:46:45 Started mapping on | Feb 12 06:46:45 Finished on | Feb 12 06:46:53 Mapping speed, Million of reads per hour | 1799.90 Number of input reads | 3999788 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3303714 Uniquely mapped reads % | 82.60% Average mapped length | 51.75 Number of splices: Total | 316784 Number of splices: Annotated (sjdb) | 312419 Number of splices: GT/AG | 309626 Number of splices: GC/AG | 5616 Number of splices: AT/AC | 495 Number of splices: Non-canonical | 1047 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462625 % of reads mapped to multiple loci | 11.57% Number of reads mapped to too many loci | 126604 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233449 233449 233449 N_multimapping 462625 462625 462625 N_noFeature 618129 3233227 676772 N_ambiguous 24970 186 12955 UnstrandedReadsAssigned:2660615 PositiveStrandReadsAssigned:70301 NegativeStrandReadsAssigned:2613987 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423315 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423315-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,788 reads, 2,951,134 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR5423315.ke.tsv 34699 SRR5423315.se.tsv 87100 total ==> SRR5423315.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 90 16.3834 Potri.005G024800.1.v4.1 1035 936 2 0.746431 Potri.004G059700.1.v4.1 961 862 3 1.21577 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.5714 7.07153 Potri.016G087400.1.v4.1 270 171 24 49.0288 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 26 10.3446 ==> SRR5423315.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 46 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423315 completed mapping pipeline successfully