Starting /dee2/code/volunteer_pipeline.sh SRR5423316 current disk space = 3050299883520 free memory = 1578930488 SRR5423316 SRAfilesize 34bea13f2a9861471ba136a5af18699d SRR5423316.sra SRR5423316.sra file validated SRR5423316 is single end SRR5423316 is conventional basespace SRR5423316 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423316_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5445 34.0 31.0 34.0 31.0 34.0 2 32.67675 34.0 31.0 34.0 31.0 34.0 3 32.772 34.0 31.0 34.0 31.0 34.0 4 36.11025 37.0 37.0 37.0 35.0 37.0 5 36.121 37.0 37.0 37.0 35.0 37.0 6 36.097 37.0 36.0 37.0 35.0 37.0 7 36.047 37.0 35.0 37.0 35.0 37.0 8 36.1005 37.0 35.0 37.0 35.0 37.0 9 37.88175 39.0 38.0 39.0 35.0 39.0 10 37.811 39.0 38.0 39.0 35.0 39.0 11 37.7265 39.0 38.0 39.0 35.0 39.0 12 37.5525 39.0 37.0 39.0 35.0 39.0 13 37.62375 39.0 37.0 39.0 35.0 39.0 14 39.114 40.0 39.0 41.0 36.0 41.0 15 39.133 40.0 38.0 41.0 36.0 41.0 16 38.986 40.0 38.0 41.0 36.0 41.0 17 39.106 40.0 38.0 41.0 36.0 41.0 18 38.8905 40.0 38.0 41.0 35.0 41.0 19 38.917 40.0 38.0 41.0 35.0 41.0 20 39.0195 40.0 39.0 41.0 35.0 41.0 21 38.89875 40.0 38.0 41.0 35.0 41.0 22 38.843 40.0 38.0 41.0 35.0 41.0 23 38.869 40.0 38.0 41.0 35.0 41.0 24 38.89675 40.0 38.0 41.0 35.0 41.0 25 38.85075 40.0 38.0 41.0 35.0 41.0 26 38.669 40.0 38.0 41.0 35.0 41.0 27 38.6475 40.0 38.0 41.0 34.0 41.0 28 38.6675 40.0 38.0 41.0 34.0 41.0 29 38.467 40.0 38.0 41.0 34.0 41.0 30 38.41925 40.0 38.0 41.0 34.0 41.0 31 38.0135 40.0 38.0 41.0 33.0 41.0 32 38.224 40.0 38.0 41.0 33.0 41.0 33 37.92975 40.0 38.0 41.0 33.0 41.0 34 37.86325 40.0 38.0 41.0 33.0 41.0 35 37.7475 40.0 38.0 41.0 32.0 41.0 36 37.65325 40.0 38.0 41.0 32.0 41.0 37 37.783 40.0 38.0 41.0 32.0 41.0 38 37.6915 40.0 38.0 41.0 33.0 41.0 39 37.72925 40.0 38.0 41.0 32.0 41.0 40 37.682 40.0 38.0 41.0 32.0 41.0 41 37.41425 40.0 37.0 41.0 31.0 41.0 42 37.53375 40.0 37.0 41.0 32.0 41.0 43 37.28725 40.0 37.0 41.0 31.0 41.0 44 37.08575 40.0 37.0 41.0 30.0 41.0 45 36.8995 40.0 36.0 41.0 30.0 41.0 46 36.9035 40.0 36.0 41.0 30.0 41.0 47 36.70775 40.0 36.0 41.0 29.0 41.0 48 36.51325 39.0 36.0 41.0 29.0 41.0 49 36.4995 39.0 35.0 41.0 29.0 41.0 50 36.53025 39.0 35.0 41.0 29.0 41.0 51 36.34025 39.0 35.0 41.0 28.0 41.0 52 34.593 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2202 1 0.0 2202 2 0.0 2202 3 0.0 2202 4 0.0 2202 5 0.0 2202 6 0.0 2202 7 0.0 2202 8 0.0 2202 9 0.0 2202 10 0.0 2202 11 0.0 2202 12 0.0 2202 13 0.0 2202 14 0.0 2202 15 0.0 2202 16 0.0 2202 17 0.0 2202 18 0.0 2202 19 0.0 2202 20 0.0 2202 21 0.0 2202 22 0.0 2202 23 0.0 2202 24 0.0 2202 25 0.0 2202 26 0.0 2202 27 0.0 2202 28 0.0 2202 29 0.0 2202 30 0.0 2202 31 0.0 2202 32 0.0 2202 33 0.0 2202 34 0.0 2202 35 0.0 2202 36 0.0 2202 37 0.0 2202 38 0.0 2202 39 0.0 2202 40 0.0 2202 41 0.0 2202 42 0.0 2202 43 0.0 2202 44 0.0 2202 45 0.0 2202 46 0.0 2202 47 0.0 2202 48 0.0 2202 49 0.0 2202 50 0.0 2202 51 0.0 2202 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 5.0 21 3.0 22 4.0 23 10.0 24 13.0 25 14.0 26 17.0 27 26.0 28 38.0 29 45.0 30 48.0 31 75.0 32 92.0 33 101.0 34 124.0 35 198.0 36 270.0 37 410.0 38 774.0 39 1724.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.4923616328575 10.693713999499122 5.334335086401202 45.47958928124217 2 23.599999999999998 13.600000000000001 34.65 28.15 3 22.650000000000002 17.075000000000003 25.025 35.25 4 25.874999999999996 26.1 20.95 27.075 5 24.375 30.925000000000004 24.95 19.75 6 20.849999999999998 32.1 24.224999999999998 22.825 7 14.95 23.075000000000003 42.0 19.975 8 18.15 21.5 31.874999999999996 28.475 9 17.925 21.349999999999998 33.975 26.75 10 19.825 35.925000000000004 25.35 18.9 11 23.875 27.05 21.85 27.224999999999998 12 22.925 23.175 26.474999999999998 27.425 13 21.275 25.85 26.974999999999998 25.900000000000002 14 20.424999999999997 26.8 26.950000000000003 25.825 15 20.225 24.675 28.825 26.275 16 21.349999999999998 25.8 26.3 26.55 17 20.75 26.325 27.05 25.874999999999996 18 21.45 26.400000000000002 27.200000000000003 24.95 19 22.175 26.125 25.6 26.1 20 22.45 25.15 26.075 26.325 21 20.974999999999998 27.800000000000004 26.674999999999997 24.55 22 21.9 26.6 26.325 25.174999999999997 23 22.325 25.525 26.525 25.624999999999996 24 22.7 25.324999999999996 25.4 26.575 25 22.15 27.425 24.775 25.650000000000002 26 22.025 26.775 25.575 25.624999999999996 27 22.075 25.650000000000002 25.85 26.424999999999997 28 22.05 26.724999999999998 25.974999999999998 25.25 29 21.3 26.05 26.974999999999998 25.674999999999997 30 20.75 25.874999999999996 25.45 27.925 31 22.175 26.275 25.324999999999996 26.224999999999998 32 21.925 26.900000000000002 25.275 25.900000000000002 33 21.95 26.875 25.95 25.224999999999998 34 21.825 26.85 25.174999999999997 26.150000000000002 35 22.525000000000002 25.55 25.15 26.775 36 21.6 26.875 25.25 26.275 37 21.7 25.174999999999997 26.375 26.75 38 22.5 25.55 25.2 26.75 39 21.075 24.9 26.55 27.474999999999998 40 22.45 25.775 25.974999999999998 25.8 41 21.975 26.450000000000003 24.75 26.825 42 21.3 26.0 25.7 27.0 43 23.0 26.650000000000002 24.099999999999998 26.25 44 23.175 25.650000000000002 25.75 25.424999999999997 45 22.175 25.4 26.674999999999997 25.75 46 22.400000000000002 25.825 25.974999999999998 25.8 47 23.7 24.825 24.575 26.900000000000002 48 22.291718789091817 26.770077558168627 25.74430823117338 25.193895421566175 49 20.555138784696176 26.63165791447862 25.03125781445361 27.781945486371594 50 22.755688922230558 26.03150787696924 25.481370342585645 25.731432858214554 51 21.79134350763072 26.419814861145856 24.893670252689517 26.8951713785339 52 23.875 24.525 25.4 26.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 4.5 19 7.0 20 6.5 21 6.0 22 9.0 23 12.0 24 12.5 25 13.0 26 17.0 27 21.0 28 25.0 29 29.0 30 41.5 31 54.0 32 65.0 33 76.0 34 84.0 35 92.0 36 110.0 37 128.0 38 151.5 39 212.5 40 250.0 41 264.0 42 278.0 43 284.5 44 291.0 45 306.0 46 321.0 47 326.0 48 331.0 49 323.5 50 316.0 51 318.5 52 321.0 53 306.0 54 291.0 55 265.0 56 239.0 57 224.5 58 210.0 59 188.0 60 166.0 61 145.0 62 124.0 63 92.5 64 62.5 65 64.0 66 58.0 67 52.0 68 38.5 69 25.0 70 20.0 71 15.0 72 11.5 73 8.0 74 7.0 75 6.0 76 4.0 77 2.0 78 3.0 79 4.0 80 3.0 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 1.0 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.075 49 0.025 50 0.025 51 0.075 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.94197595399896 92.72500000000001 2 2.247778358599059 4.3 3 0.4181913225300575 1.2 4 0.26136957658128596 1.0 5 0.052273915316257184 0.25 6 0.026136957658128592 0.15 7 0.026136957658128592 0.17500000000000002 8 0.026136957658128592 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 8 0.2 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 7 0.17500000000000002 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 6 0.15 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra Read 200000 spots for SRR5423316.sra Written 200000 spots for SRR5423316.sra SRR ids: ['SRR5423316.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vt4ytn9q SRR5423316.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423316 file size 703975 SRR5423316 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423316 SRR5423316_1.fastq Input file: SRR5423316_1.fastq trimmed: SRR5423316-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:46:06 2025 >> started Wed Feb 12 06:46:09 2025 >> done (2.712s) 4000000 reads processed; of these: 126 ( 0.00%) short reads filtered out after trimming by size control 64 ( 0.00%) empty reads filtered out after trimming by size control 3999810 (100.00%) reads available; of these: 95910 ( 2.40%) trimmed reads available after processing 3903900 (97.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 11 0.00% 25 8 0.00% 26 11 0.00% 27 16 0.00% 28 13 0.00% 29 15 0.00% 30 18 0.00% 31 29 0.00% 32 33 0.00% 33 34 0.00% 34 55 0.00% 35 59 0.00% 36 61 0.00% 37 97 0.00% 38 84 0.00% 39 154 0.00% 40 173 0.00% 41 220 0.01% 42 302 0.01% 43 366 0.01% 44 684 0.02% 45 742 0.02% 46 1031 0.03% 47 1437 0.04% 48 2371 0.06% 49 5027 0.13% 50 12626 0.32% 51 70222 1.76% 52 3903900 97.60% 3999810 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=23.52 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 06:46:23 Started mapping on | Feb 12 06:46:24 Finished on | Feb 12 06:46:29 Mapping speed, Million of reads per hour | 2879.86 Number of input reads | 3999810 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3306126 Uniquely mapped reads % | 82.66% Average mapped length | 51.77 Number of splices: Total | 317754 Number of splices: Annotated (sjdb) | 313432 Number of splices: GT/AG | 310501 Number of splices: GC/AG | 5750 Number of splices: AT/AC | 506 Number of splices: Non-canonical | 997 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462846 % of reads mapped to multiple loci | 11.57% Number of reads mapped to too many loci | 122786 % of reads mapped to too many loci | 3.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230838 230838 230838 N_multimapping 462846 462846 462846 N_noFeature 616610 3234314 676810 N_ambiguous 24812 180 13032 UnstrandedReadsAssigned:2664704 PositiveStrandReadsAssigned:71632 NegativeStrandReadsAssigned:2616284 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423316 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423316-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,810 reads, 2,975,732 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR5423316.ke.tsv 34699 SRR5423316.se.tsv 87100 total ==> SRR5423316.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 89 16.0041 Potri.005G024800.1.v4.1 1035 936 3 1.10601 Potri.004G059700.1.v4.1 961 862 2 0.800641 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 86.5565 10.5023 Potri.016G087400.1.v4.1 270 171 24 48.4318 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 41 16.114 ==> SRR5423316.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 36 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423316 completed mapping pipeline successfully