Starting /dee2/code/volunteer_pipeline.sh SRR5423317 current disk space = 3050283929600 free memory = 1298926792 SRR5423317 SRAfilesize 99721ebe5087c524006e3eadd9ecfd9e SRR5423317.sra SRR5423317.sra file validated SRR5423317 is single end SRR5423317 is conventional basespace SRR5423317 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13 34.0 31.0 34.0 30.0 34.0 2 32.226 34.0 31.0 34.0 30.0 34.0 3 32.2665 34.0 31.0 34.0 30.0 34.0 4 35.71775 37.0 35.0 37.0 33.0 37.0 5 35.625 37.0 35.0 37.0 33.0 37.0 6 35.7315 37.0 35.0 37.0 33.0 37.0 7 35.69975 37.0 35.0 37.0 33.0 37.0 8 35.69625 37.0 35.0 37.0 33.0 37.0 9 37.52375 39.0 37.0 39.0 35.0 39.0 10 37.199 39.0 37.0 39.0 33.0 39.0 11 37.31675 39.0 37.0 39.0 34.0 39.0 12 37.334 39.0 37.0 39.0 34.0 39.0 13 37.2795 39.0 37.0 39.0 34.0 39.0 14 38.4385 40.0 38.0 41.0 34.0 41.0 15 38.495 40.0 38.0 41.0 34.0 41.0 16 38.328 40.0 38.0 41.0 33.0 41.0 17 38.48175 40.0 38.0 41.0 34.0 41.0 18 38.47625 40.0 38.0 41.0 34.0 41.0 19 38.511 40.0 38.0 41.0 34.0 41.0 20 38.4425 40.0 38.0 41.0 34.0 41.0 21 38.52275 40.0 38.0 41.0 34.0 41.0 22 38.67875 40.0 38.0 41.0 35.0 41.0 23 38.43 40.0 38.0 41.0 34.0 41.0 24 38.39125 40.0 38.0 41.0 34.0 41.0 25 38.33975 40.0 38.0 41.0 34.0 41.0 26 38.22725 40.0 38.0 41.0 34.0 41.0 27 38.32575 40.0 38.0 41.0 34.0 41.0 28 38.2565 40.0 38.0 41.0 33.0 41.0 29 38.17275 40.0 38.0 41.0 33.0 41.0 30 38.209 40.0 38.0 41.0 33.0 41.0 31 38.17325 40.0 38.0 41.0 33.0 41.0 32 38.033 40.0 38.0 41.0 33.0 41.0 33 38.11225 40.0 38.0 41.0 33.0 41.0 34 37.69375 40.0 37.0 41.0 32.0 41.0 35 37.687 40.0 37.0 41.0 32.0 41.0 36 37.8795 40.0 37.0 41.0 33.0 41.0 37 37.70025 40.0 37.0 41.0 32.0 41.0 38 37.6495 40.0 37.0 41.0 31.0 41.0 39 37.68075 40.0 37.0 41.0 32.0 41.0 40 37.5605 40.0 37.0 41.0 32.0 41.0 41 37.3525 40.0 36.0 41.0 31.0 41.0 42 37.40875 40.0 37.0 41.0 31.0 41.0 43 37.275 40.0 36.0 41.0 31.0 41.0 44 37.154 39.0 36.0 41.0 31.0 41.0 45 37.2015 39.0 36.0 41.0 31.0 41.0 46 36.96425 39.0 36.0 41.0 30.0 41.0 47 36.83725 39.0 35.0 41.0 30.0 41.0 48 37.017 39.0 35.0 41.0 31.0 41.0 49 36.793 39.0 35.0 41.0 30.0 41.0 50 36.56125 39.0 35.0 41.0 30.0 41.0 51 36.79225 39.0 35.0 41.0 30.0 41.0 52 35.74925 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2210 1 0.0 2210 2 0.0 2210 3 0.0 2210 4 0.0 2210 5 0.0 2210 6 0.0 2210 7 0.0 2210 8 0.0 2210 9 0.0 2210 10 0.0 2210 11 0.0 2210 12 0.0 2210 13 0.0 2210 14 0.0 2210 15 0.0 2210 16 0.0 2210 17 0.0 2210 18 0.0 2210 19 0.0 2210 20 0.0 2210 21 0.0 2210 22 0.0 2210 23 0.0 2210 24 0.0 2210 25 0.0 2210 26 0.0 2210 27 0.0 2210 28 0.0 2210 29 0.0 2210 30 0.0 2210 31 0.0 2210 32 0.0 2210 33 0.0 2210 34 0.0 2210 35 0.0 2210 36 0.0 2210 37 0.0 2210 38 0.0 2210 39 0.0 2210 40 0.0 2210 41 0.0 2210 42 0.0 2210 43 0.0 2210 44 0.0 2210 45 0.0 2210 46 0.0 2210 47 0.0 2210 48 0.0 2210 49 0.0 2210 50 0.0 2210 51 0.0 2210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 5.0 24 10.0 25 15.0 26 19.0 27 26.0 28 43.0 29 40.0 30 60.0 31 73.0 32 111.0 33 132.0 34 166.0 35 257.0 36 355.0 37 464.0 38 720.0 39 1497.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.02255639097744 10.12531328320802 6.190476190476191 44.661654135338345 2 22.3 14.025000000000002 35.75 27.925 3 22.05 17.675 24.15 36.125 4 25.6 25.224999999999998 21.025 28.15 5 25.0 31.624999999999996 22.575 20.8 6 20.025000000000002 33.5 23.75 22.725 7 16.25 22.725 41.449999999999996 19.575 8 17.525 22.125 31.35 28.999999999999996 9 18.15 21.55 33.625 26.674999999999997 10 19.175 36.449999999999996 23.5 20.875 11 23.549999999999997 26.875 22.125 27.450000000000003 12 22.2 24.4 26.125 27.275 13 20.3 27.85 26.950000000000003 24.9 14 21.05 26.35 26.875 25.724999999999998 15 20.7 25.650000000000002 27.775 25.874999999999996 16 19.875 26.424999999999997 26.224999999999998 27.474999999999998 17 21.075 25.924999999999997 27.05 25.95 18 21.45 26.424999999999997 25.724999999999998 26.400000000000002 19 22.25 26.1 26.5 25.15 20 21.575 26.125 27.975 24.325 21 21.9 25.35 25.4 27.35 22 22.0 26.875 25.525 25.6 23 21.8 27.125 24.75 26.325 24 21.325 26.400000000000002 26.150000000000002 26.125 25 22.95 26.3 25.324999999999996 25.424999999999997 26 22.075 25.4 26.724999999999998 25.8 27 21.925 25.825 26.0 26.25 28 21.85 25.525 26.900000000000002 25.724999999999998 29 20.4 26.400000000000002 27.675 25.525 30 20.474999999999998 24.349999999999998 28.075 27.1 31 21.45 25.825 27.575 25.15 32 22.475 25.874999999999996 26.474999999999998 25.174999999999997 33 21.8 24.55 27.150000000000002 26.5 34 21.55 25.95 27.275 25.224999999999998 35 23.275000000000002 26.05 24.55 26.125 36 21.925 26.724999999999998 25.1 26.25 37 22.525000000000002 24.875 25.7 26.900000000000002 38 23.025000000000002 25.424999999999997 24.95 26.6 39 21.55 24.525 26.700000000000003 27.224999999999998 40 21.925 26.450000000000003 26.875 24.75 41 21.975 24.725 25.974999999999998 27.325 42 21.95 26.05 25.55 26.450000000000003 43 23.125 26.575 24.3 26.0 44 22.625 24.65 27.175 25.55 45 22.525000000000002 24.275 25.3 27.900000000000002 46 21.95 26.025 25.124999999999996 26.900000000000002 47 23.849999999999998 25.6 24.775 25.775 48 23.417563172379285 24.993745308981737 25.594195646735052 25.99449587190393 49 22.5 25.4 23.674999999999997 28.425 50 22.900000000000002 25.324999999999996 24.45 27.325 51 21.2 25.874999999999996 25.4 27.525 52 22.225 25.55 25.7 26.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 3.5 19 6.0 20 6.5 21 7.0 22 6.5 23 6.0 24 11.0 25 16.0 26 18.5 27 21.0 28 29.0 29 37.0 30 43.0 31 49.0 32 59.5 33 70.0 34 95.0 35 120.0 36 129.0 37 138.0 38 170.5 39 210.0 40 217.0 41 226.0 42 235.0 43 261.0 44 287.0 45 300.5 46 314.0 47 316.5 48 319.0 49 316.5 50 314.0 51 326.0 52 338.0 53 323.5 54 309.0 55 290.5 56 272.0 57 225.5 58 179.0 59 164.5 60 150.0 61 141.0 62 132.0 63 102.0 64 65.5 65 59.0 66 50.5 67 42.0 68 36.0 69 30.0 70 23.0 71 16.0 72 14.0 73 12.0 74 10.0 75 8.0 76 7.0 77 6.0 78 7.0 79 8.0 80 4.5 81 1.0 82 2.0 83 3.0 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.075 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 96.58434051497635 91.9 2 2.3384130320546506 4.45 3 0.6568575932737782 1.875 4 0.2890173410404624 1.0999999999999999 5 0.0788229111928534 0.375 6 0.05254860746190226 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCATATTAGGGAAAGGAGAGCACGGGGAAGAGGGGGCTCGGCCCGATCAT 6 0.15 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 6 0.15 No Hit GGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAG 5 0.125 No Hit GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra Read 200000 spots for SRR5423317.sra Written 200000 spots for SRR5423317.sra SRR ids: ['SRR5423317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d6993jj6 SRR5423317.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423317 file size 703953 SRR5423317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423317 SRR5423317_1.fastq Input file: SRR5423317_1.fastq trimmed: SRR5423317-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:29:30 2025 >> started Wed Feb 12 06:29:31 2025 >> done (1.931s) 4000000 reads processed; of these: 166 ( 0.00%) short reads filtered out after trimming by size control 78 ( 0.00%) empty reads filtered out after trimming by size control 3999756 (99.99%) reads available; of these: 81590 ( 2.04%) trimmed reads available after processing 3918166 (97.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 4 0.00% 25 10 0.00% 26 4 0.00% 27 5 0.00% 28 13 0.00% 29 9 0.00% 30 9 0.00% 31 12 0.00% 32 22 0.00% 33 20 0.00% 34 29 0.00% 35 28 0.00% 36 44 0.00% 37 48 0.00% 38 50 0.00% 39 82 0.00% 40 96 0.00% 41 128 0.00% 42 148 0.00% 43 187 0.00% 44 353 0.01% 45 465 0.01% 46 715 0.02% 47 914 0.02% 48 1637 0.04% 49 3604 0.09% 50 10223 0.26% 51 62717 1.57% 52 3918166 97.96% 3999756 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.12 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 06:29:50 Started mapping on | Feb 12 06:29:51 Finished on | Feb 12 06:29:57 Mapping speed, Million of reads per hour | 2399.85 Number of input reads | 3999756 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305676 Uniquely mapped reads % | 82.65% Average mapped length | 51.77 Number of splices: Total | 317789 Number of splices: Annotated (sjdb) | 313416 Number of splices: GT/AG | 310401 Number of splices: GC/AG | 5850 Number of splices: AT/AC | 502 Number of splices: Non-canonical | 1036 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462037 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 125870 % of reads mapped to too many loci | 3.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232043 232043 232043 N_multimapping 462037 462037 462037 N_noFeature 617649 3234773 676831 N_ambiguous 24885 209 12967 UnstrandedReadsAssigned:2663142 PositiveStrandReadsAssigned:70694 NegativeStrandReadsAssigned:2615878 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423317 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423317-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,756 reads, 2,969,837 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR5423317.ke.tsv 34699 SRR5423317.se.tsv 87100 total ==> SRR5423317.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 86 15.5156 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 3 1.20492 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 56.1752 6.83847 Potri.016G087400.1.v4.1 270 171 23 46.5667 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.413636 Potri.012G127500.1.v4.1 977 878 36 14.1955 ==> SRR5423317.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423317 completed mapping pipeline successfully