Starting /dee2/code/volunteer_pipeline.sh SRR5423318 current disk space = 3050086580224 free memory = 1576053488 SRR5423318 SRAfilesize f241ea46ff3c2bdbdeae406f266e824f SRR5423318.sra SRR5423318.sra file validated SRR5423318 is single end SRR5423318 is conventional basespace SRR5423318 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423318_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57675 34.0 31.0 34.0 31.0 34.0 2 32.6655 34.0 31.0 34.0 31.0 34.0 3 32.77425 34.0 31.0 34.0 31.0 34.0 4 36.193 37.0 37.0 37.0 35.0 37.0 5 36.16325 37.0 37.0 37.0 35.0 37.0 6 36.10325 37.0 36.0 37.0 35.0 37.0 7 35.84025 37.0 35.0 37.0 35.0 37.0 8 36.03725 37.0 35.0 37.0 35.0 37.0 9 37.81025 39.0 38.0 39.0 35.0 39.0 10 37.7525 39.0 38.0 39.0 35.0 39.0 11 37.831 39.0 38.0 39.0 35.0 39.0 12 37.774 39.0 38.0 39.0 35.0 39.0 13 37.75075 39.0 38.0 39.0 35.0 39.0 14 39.198 40.0 39.0 41.0 36.0 41.0 15 39.2675 40.0 39.0 41.0 36.0 41.0 16 39.10175 40.0 39.0 41.0 36.0 41.0 17 39.0955 40.0 39.0 41.0 36.0 41.0 18 39.03675 40.0 39.0 41.0 36.0 41.0 19 39.08325 40.0 39.0 41.0 36.0 41.0 20 38.8595 40.0 38.0 41.0 35.0 41.0 21 38.7535 40.0 38.0 41.0 34.0 41.0 22 38.95 40.0 39.0 41.0 35.0 41.0 23 38.976 40.0 39.0 41.0 35.0 41.0 24 38.869 40.0 38.0 41.0 35.0 41.0 25 38.90625 40.0 38.0 41.0 35.0 41.0 26 38.7055 40.0 38.0 41.0 35.0 41.0 27 37.75675 40.0 37.0 41.0 32.0 41.0 28 38.36825 40.0 38.0 41.0 34.0 41.0 29 38.53125 40.0 38.0 41.0 34.0 41.0 30 38.58375 40.0 38.0 41.0 34.0 41.0 31 38.5015 40.0 38.0 41.0 34.0 41.0 32 38.39325 40.0 38.0 41.0 34.0 41.0 33 38.29 40.0 38.0 41.0 34.0 41.0 34 38.15075 40.0 38.0 41.0 33.0 41.0 35 38.3045 40.0 38.0 41.0 33.0 41.0 36 38.3525 40.0 38.0 41.0 34.0 41.0 37 38.20975 40.0 38.0 41.0 33.0 41.0 38 38.22175 40.0 38.0 41.0 33.0 41.0 39 38.07625 40.0 38.0 41.0 33.0 41.0 40 37.9725 40.0 38.0 41.0 33.0 41.0 41 37.88175 40.0 38.0 41.0 33.0 41.0 42 37.923 40.0 38.0 41.0 33.0 41.0 43 37.69425 40.0 37.0 41.0 32.0 41.0 44 37.77775 40.0 37.0 41.0 32.0 41.0 45 37.55825 40.0 37.0 41.0 32.0 41.0 46 37.245 40.0 37.0 41.0 31.0 41.0 47 37.09325 40.0 36.0 41.0 31.0 41.0 48 37.2155 40.0 36.0 41.0 31.0 41.0 49 37.20625 40.0 36.0 41.0 31.0 41.0 50 37.1655 40.0 36.0 41.0 31.0 41.0 51 37.0725 40.0 36.0 41.0 31.0 41.0 52 35.55225 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2302 1 0.0 2302 2 0.0 2302 3 0.0 2302 4 0.0 2302 5 0.0 2302 6 0.0 2302 7 0.0 2302 8 0.0 2302 9 0.0 2302 10 0.0 2302 11 0.0 2302 12 0.0 2302 13 0.0 2302 14 0.0 2302 15 0.0 2302 16 0.0 2302 17 0.0 2302 18 0.0 2302 19 0.0 2302 20 0.0 2302 21 0.0 2302 22 0.0 2302 23 0.0 2302 24 0.0 2302 25 0.0 2302 26 0.0 2302 27 0.0 2302 28 0.0 2302 29 0.0 2302 30 0.0 2302 31 0.0 2302 32 0.0 2302 33 0.0 2302 34 0.0 2302 35 0.0 2302 36 0.0 2302 37 0.0 2302 38 0.0 2302 39 0.0 2302 40 0.0 2302 41 0.0 2302 42 0.0 2302 43 0.0 2302 44 0.0 2302 45 0.0 2302 46 0.0 2302 47 0.0 2302 48 0.0 2302 49 0.0 2302 50 0.0 2302 51 0.0 2302 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 1.0 21 3.0 22 5.0 23 6.0 24 10.0 25 9.0 26 15.0 27 24.0 28 32.0 29 38.0 30 49.0 31 74.0 32 84.0 33 105.0 34 114.0 35 170.0 36 261.0 37 380.0 38 757.0 39 1852.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.91391391391391 10.285285285285285 5.355355355355355 45.44544544544545 2 23.35 14.025000000000002 34.525 28.1 3 21.775 17.2 24.65 36.375 4 25.374999999999996 25.674999999999997 20.575 28.375 5 26.325 29.625 22.75 21.3 6 19.575 32.275 24.45 23.7 7 15.275 23.849999999999998 40.35 20.525 8 18.75 21.625 30.525000000000002 29.099999999999998 9 19.975 20.05 33.550000000000004 26.424999999999997 10 19.05 37.2 23.925 19.825 11 23.674999999999997 27.275 21.725 27.325 12 23.325000000000003 22.900000000000002 26.75 27.025 13 20.5 27.025 27.175 25.3 14 20.275000000000002 27.3 27.825 24.6 15 21.5 25.825 26.05 26.625 16 21.5 26.5 26.400000000000002 25.6 17 22.575 26.875 25.424999999999997 25.124999999999996 18 22.475 25.575 25.900000000000002 26.05 19 21.725 26.325 25.775 26.174999999999997 20 21.930482620655166 26.38159539884971 25.831457864466117 25.85646411602901 21 22.775000000000002 26.0 25.8 25.424999999999997 22 21.925 26.974999999999998 25.424999999999997 25.674999999999997 23 23.075000000000003 25.900000000000002 24.9 26.125 24 22.400000000000002 25.924999999999997 25.324999999999996 26.35 25 21.775 26.55 24.975 26.700000000000003 26 21.7 25.0 26.974999999999998 26.325 27 22.225 25.474999999999998 25.724999999999998 26.575 28 22.85 24.75 27.375 25.025 29 21.725 25.825 27.275 25.174999999999997 30 22.375 24.099999999999998 27.400000000000002 26.125 31 21.85 25.3 27.900000000000002 24.95 32 21.975 25.3 26.474999999999998 26.25 33 22.025 26.3 25.624999999999996 26.05 34 21.775 26.0 26.174999999999997 26.05 35 22.2 25.3 25.8 26.700000000000003 36 22.8 25.25 25.35 26.6 37 21.3 25.575 25.474999999999998 27.650000000000002 38 22.225 25.35 26.375 26.05 39 19.875 25.3 26.150000000000002 28.675 40 20.95 25.35 27.075 26.625 41 22.375 25.35 26.025 26.25 42 22.375 25.650000000000002 25.55 26.424999999999997 43 21.224999999999998 27.175 26.5 25.1 44 22.6 25.775 24.975 26.650000000000002 45 21.725 25.25 25.074999999999996 27.950000000000003 46 22.875 25.4 25.825 25.900000000000002 47 22.8 25.25 25.525 26.424999999999997 48 21.43035758939735 24.33108277069267 27.25681420355089 26.981745436359088 49 22.85571392848212 24.90622655663916 24.956239059764943 27.28182045511378 50 22.280570142535634 25.656414103525883 24.281070267566893 27.781945486371594 51 23.05 24.525 25.3 27.125 52 23.05 25.674999999999997 24.875 26.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 2.0 16 1.5 17 1.0 18 2.0 19 3.0 20 3.5 21 4.0 22 7.0 23 10.0 24 11.0 25 12.0 26 19.0 27 26.0 28 32.0 29 38.0 30 39.5 31 41.0 32 59.0 33 77.0 34 88.0 35 99.0 36 113.0 37 127.0 38 139.0 39 189.0 40 227.0 41 238.0 42 249.0 43 275.5 44 302.0 45 323.0 46 344.0 47 342.0 48 340.0 49 320.5 50 301.0 51 311.0 52 321.0 53 319.0 54 317.0 55 273.0 56 229.0 57 212.0 58 195.0 59 179.5 60 164.0 61 148.0 62 132.0 63 108.5 64 79.5 65 74.0 66 61.5 67 49.0 68 37.0 69 25.0 70 21.5 71 18.0 72 15.0 73 12.0 74 9.0 75 6.0 76 7.0 77 8.0 78 5.5 79 3.0 80 2.5 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.025 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.81830134104655 92.05 2 2.077307388903497 3.95 3 0.6047856955035499 1.725 4 0.2629503023928477 1.0 5 0.1051801209571391 0.5 6 0.1051801209571391 0.6 7 0.026295030239284777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 7 0.17500000000000002 No Hit ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 6 0.15 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit GTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGAATAACTGTAGCAATTG 5 0.125 No Hit CCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACAGG 5 0.125 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra Read 200000 spots for SRR5423318.sra Written 200000 spots for SRR5423318.sra SRR ids: ['SRR5423318.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rly4obfu SRR5423318.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423318 file size 703959 SRR5423318 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423318 SRR5423318_1.fastq Input file: SRR5423318_1.fastq trimmed: SRR5423318-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:00:56 2025 >> started Wed Feb 12 07:00:59 2025 >> done (2.692s) 4000000 reads processed; of these: 134 ( 0.00%) short reads filtered out after trimming by size control 70 ( 0.00%) empty reads filtered out after trimming by size control 3999796 (99.99%) reads available; of these: 73531 ( 1.84%) trimmed reads available after processing 3926265 (98.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 6 0.00% 25 10 0.00% 26 6 0.00% 27 9 0.00% 28 7 0.00% 29 7 0.00% 30 10 0.00% 31 9 0.00% 32 18 0.00% 33 28 0.00% 34 27 0.00% 35 37 0.00% 36 39 0.00% 37 71 0.00% 38 85 0.00% 39 106 0.00% 40 109 0.00% 41 166 0.00% 42 203 0.01% 43 211 0.01% 44 459 0.01% 45 596 0.01% 46 762 0.02% 47 1022 0.03% 48 1631 0.04% 49 3930 0.10% 50 9208 0.23% 51 54743 1.37% 52 3926265 98.16% 3999796 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=30.26 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:01:11 Started mapping on | Feb 12 07:01:11 Finished on | Feb 12 07:01:18 Mapping speed, Million of reads per hour | 2057.04 Number of input reads | 3999796 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3304778 Uniquely mapped reads % | 82.62% Average mapped length | 51.78 Number of splices: Total | 318211 Number of splices: Annotated (sjdb) | 313803 Number of splices: GT/AG | 310896 Number of splices: GC/AG | 5774 Number of splices: AT/AC | 536 Number of splices: Non-canonical | 1005 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461278 % of reads mapped to multiple loci | 11.53% Number of reads mapped to too many loci | 126979 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233740 233740 233740 N_multimapping 461278 461278 461278 N_noFeature 619793 3232797 679993 N_ambiguous 25137 173 13200 UnstrandedReadsAssigned:2659848 PositiveStrandReadsAssigned:71808 NegativeStrandReadsAssigned:2611585 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423318 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423318-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,796 reads, 2,943,057 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR5423318.ke.tsv 34699 SRR5423318.se.tsv 87100 total ==> SRR5423318.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 86 15.6455 Potri.005G024800.1.v4.1 1035 936 4 1.49194 Potri.004G059700.1.v4.1 961 862 6 2.43002 Potri.007G009000.2.v4.1 1416 1317 1 0.265082 Potri.003G141000.2.v4.1 2943 2844 63.5801 7.80473 Potri.016G087400.1.v4.1 270 171 33 67.3727 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.20855 Potri.012G127500.1.v4.1 977 878 26 10.3382 ==> SRR5423318.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 30 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423318 completed mapping pipeline successfully