Starting /dee2/code/volunteer_pipeline.sh SRR5423319 current disk space = 3049996398592 free memory = 1579106052 SRR5423319 SRAfilesize 7f002134bb1449f7ab2d08b64a7fea89 SRR5423319.sra SRR5423319.sra file validated SRR5423319 is single end SRR5423319 is conventional basespace SRR5423319 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423319_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02425 33.0 31.0 34.0 30.0 34.0 2 32.2035 34.0 31.0 34.0 30.0 34.0 3 32.27675 34.0 31.0 34.0 30.0 34.0 4 35.692 37.0 35.0 37.0 33.0 37.0 5 35.7305 37.0 35.0 37.0 33.0 37.0 6 35.68975 37.0 35.0 37.0 33.0 37.0 7 35.685 37.0 35.0 37.0 33.0 37.0 8 35.623 37.0 35.0 37.0 33.0 37.0 9 37.33275 39.0 37.0 39.0 34.0 39.0 10 37.35925 39.0 37.0 39.0 34.0 39.0 11 37.41525 39.0 37.0 39.0 34.0 39.0 12 37.34525 39.0 37.0 39.0 34.0 39.0 13 37.03175 39.0 37.0 39.0 33.0 39.0 14 38.577 40.0 38.0 41.0 34.0 41.0 15 38.66 40.0 38.0 41.0 34.0 41.0 16 38.58675 40.0 38.0 41.0 34.0 41.0 17 38.44925 40.0 38.0 41.0 33.0 41.0 18 38.4505 40.0 38.0 41.0 34.0 41.0 19 38.5025 40.0 38.0 41.0 34.0 41.0 20 38.48575 40.0 38.0 41.0 34.0 41.0 21 38.4665 40.0 38.0 41.0 34.0 41.0 22 38.568 40.0 38.0 41.0 34.0 41.0 23 38.40825 40.0 38.0 41.0 34.0 41.0 24 38.27325 40.0 38.0 41.0 33.0 41.0 25 38.39625 40.0 38.0 41.0 34.0 41.0 26 38.33925 40.0 38.0 41.0 34.0 41.0 27 38.14775 40.0 38.0 41.0 33.0 41.0 28 38.242 40.0 38.0 41.0 34.0 41.0 29 38.2465 40.0 38.0 41.0 33.0 41.0 30 38.14875 40.0 38.0 41.0 33.0 41.0 31 38.27175 40.0 38.0 41.0 34.0 41.0 32 38.2225 40.0 38.0 41.0 33.0 41.0 33 38.14675 40.0 38.0 41.0 33.0 41.0 34 38.10175 40.0 37.0 41.0 33.0 41.0 35 38.03575 40.0 37.0 41.0 33.0 41.0 36 38.0305 40.0 37.0 41.0 33.0 41.0 37 37.85575 40.0 37.0 41.0 32.0 41.0 38 37.823 40.0 37.0 41.0 33.0 41.0 39 37.63325 40.0 37.0 41.0 32.0 41.0 40 37.72325 40.0 37.0 41.0 32.0 41.0 41 37.5755 40.0 37.0 41.0 32.0 41.0 42 37.5045 40.0 37.0 41.0 31.0 41.0 43 37.506 40.0 36.0 41.0 31.0 41.0 44 37.36925 40.0 36.0 41.0 31.0 41.0 45 37.554 40.0 36.0 41.0 32.0 41.0 46 37.37675 39.0 36.0 41.0 31.0 41.0 47 37.26725 39.0 36.0 41.0 31.0 41.0 48 37.05175 39.0 36.0 41.0 31.0 41.0 49 36.89925 39.0 35.0 41.0 30.0 41.0 50 36.90275 39.0 35.0 41.0 30.0 41.0 51 36.8815 39.0 35.0 41.0 31.0 41.0 52 35.92825 38.0 34.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2311 1 0.0 2311 2 0.0 2311 3 0.0 2311 4 0.0 2311 5 0.0 2311 6 0.0 2311 7 0.0 2311 8 0.0 2311 9 0.0 2311 10 0.0 2311 11 0.0 2311 12 0.0 2311 13 0.0 2311 14 0.0 2311 15 0.0 2311 16 0.0 2311 17 0.0 2311 18 0.0 2311 19 0.0 2311 20 0.0 2311 21 0.0 2311 22 0.0 2311 23 0.0 2311 24 0.0 2311 25 0.0 2311 26 0.0 2311 27 0.0 2311 28 0.0 2311 29 0.0 2311 30 0.0 2311 31 0.0 2311 32 0.0 2311 33 0.0 2311 34 0.0 2311 35 0.0 2311 36 0.0 2311 37 0.0 2311 38 0.0 2311 39 0.0 2311 40 0.0 2311 41 0.0 2311 42 0.0 2311 43 0.0 2311 44 0.0 2311 45 0.0 2311 46 0.0 2311 47 0.0 2311 48 0.0 2311 49 0.0 2311 50 0.0 2311 51 0.0 2311 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 3.0 24 10.0 25 9.0 26 17.0 27 28.0 28 37.0 29 40.0 30 58.0 31 83.0 32 106.0 33 142.0 34 158.0 35 243.0 36 307.0 37 438.0 38 746.0 39 1563.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5709992486852 10.368144252441773 6.361131980966691 42.69972451790633 2 24.625 13.975000000000001 34.175 27.224999999999998 3 21.7 18.475 24.325 35.5 4 25.55 26.125 22.025 26.3 5 25.35 29.549999999999997 24.224999999999998 20.875 6 20.025000000000002 32.824999999999996 24.224999999999998 22.925 7 15.475 21.375 42.9 20.25 8 18.075 22.5 31.424999999999997 28.000000000000004 9 19.175 19.725 34.025 27.075 10 17.9 38.3 24.05 19.75 11 23.849999999999998 26.8 22.625 26.724999999999998 12 22.55 23.525 26.5 27.425 13 19.85 26.724999999999998 28.125 25.3 14 20.974999999999998 25.8 28.1 25.124999999999996 15 20.4 26.075 26.85 26.674999999999997 16 21.224999999999998 25.674999999999997 26.974999999999998 26.125 17 20.825 26.474999999999998 26.900000000000002 25.8 18 22.35 23.825 27.575 26.25 19 22.025 27.075 25.924999999999997 24.975 20 21.15 26.1 27.525 25.224999999999998 21 22.15 24.75 26.1 27.0 22 19.85 27.875 25.05 27.224999999999998 23 21.475 26.05 25.124999999999996 27.35 24 21.7 26.275 25.575 26.450000000000003 25 22.05 25.474999999999998 25.575 26.900000000000002 26 21.95 26.325 25.5 26.224999999999998 27 21.925 25.474999999999998 25.75 26.85 28 21.625 26.724999999999998 25.95 25.7 29 21.575 26.224999999999998 26.8 25.4 30 20.9 24.875 27.625 26.6 31 22.025 25.624999999999996 26.075 26.275 32 21.75 25.275 26.75 26.224999999999998 33 22.650000000000002 24.3 26.875 26.174999999999997 34 20.849999999999998 27.325 26.325 25.5 35 21.0 26.35 24.75 27.900000000000002 36 21.125 25.6 25.974999999999998 27.3 37 21.0 25.25 25.8 27.950000000000003 38 21.6 25.5 26.200000000000003 26.700000000000003 39 21.95 24.725 25.95 27.375 40 22.675 25.15 25.8 26.375 41 22.1 27.35 25.1 25.45 42 20.825 25.1 26.775 27.3 43 22.425 25.074999999999996 26.150000000000002 26.35 44 23.075000000000003 25.575 25.624999999999996 25.724999999999998 45 23.1 25.25 24.75 26.900000000000002 46 23.25 25.25 24.75 26.75 47 23.674999999999997 25.4 24.5 26.424999999999997 48 22.775000000000002 24.875 25.624999999999996 26.724999999999998 49 22.675 26.0 23.775 27.55 50 23.25 25.6 24.275 26.875 51 22.225 24.6 25.95 27.224999999999998 52 22.55 25.525 25.6 26.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 2.0 17 4.0 18 4.5 19 5.0 20 6.0 21 7.0 22 10.5 23 14.0 24 11.5 25 9.0 26 19.0 27 29.0 28 31.0 29 33.0 30 39.0 31 45.0 32 58.0 33 71.0 34 93.0 35 115.0 36 134.0 37 153.0 38 170.5 39 205.5 40 223.0 41 237.5 42 252.0 43 269.0 44 286.0 45 290.5 46 295.0 47 305.0 48 315.0 49 328.0 50 341.0 51 317.5 52 294.0 53 300.0 54 306.0 55 267.0 56 228.0 57 195.5 58 163.0 59 169.5 60 176.0 61 157.0 62 138.0 63 120.0 64 89.0 65 76.0 66 66.0 67 56.0 68 41.5 69 27.0 70 23.0 71 19.0 72 13.0 73 7.0 74 8.0 75 9.0 76 7.0 77 5.0 78 4.0 79 3.0 80 3.0 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.45483193277312 91.825 2 2.652310924369748 5.050000000000001 3 0.4989495798319327 1.425 4 0.23634453781512604 0.8999999999999999 5 0.13130252100840337 0.625 6 0.0 0.0 7 0.026260504201680673 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 7 0.17500000000000002 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160480 spots for SRR5423319.sra Written 160480 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra Read 160477 spots for SRR5423319.sra Written 160477 spots for SRR5423319.sra SRR ids: ['SRR5423319.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fj5r6c9p SRR5423319.sra spots: 3209543 blocks: [[1, 160477], [160478, 320954], [320955, 481431], [481432, 641908], [641909, 802385], [802386, 962862], [962863, 1123339], [1123340, 1283816], [1283817, 1444293], [1444294, 1604770], [1604771, 1765247], [1765248, 1925724], [1925725, 2086201], [2086202, 2246678], [2246679, 2407155], [2407156, 2567632], [2567633, 2728109], [2728110, 2888586], [2888587, 3049063], [3049064, 3209543]] SRR5423319 file size 564619 SRR5423319 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423319 SRR5423319_1.fastq Input file: SRR5423319_1.fastq trimmed: SRR5423319-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:11:43 2025 >> started Wed Feb 12 07:11:45 2025 >> done (1.525s) 3209543 reads processed; of these: 131 ( 0.00%) short reads filtered out after trimming by size control 52 ( 0.00%) empty reads filtered out after trimming by size control 3209360 (99.99%) reads available; of these: 52130 ( 1.62%) trimmed reads available after processing 3157230 (98.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 3 0.00% 33 5 0.00% 34 7 0.00% 35 10 0.00% 36 8 0.00% 37 13 0.00% 38 19 0.00% 39 21 0.00% 40 27 0.00% 41 33 0.00% 42 45 0.00% 43 66 0.00% 44 114 0.00% 45 156 0.00% 46 222 0.01% 47 394 0.01% 48 797 0.02% 49 1772 0.06% 50 5769 0.18% 51 42635 1.33% 52 3157230 98.38% 3209360 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.72 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 07:11:58 Started mapping on | Feb 12 07:11:58 Finished on | Feb 12 07:12:05 Mapping speed, Million of reads per hour | 1650.53 Number of input reads | 3209360 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2650795 Uniquely mapped reads % | 82.60% Average mapped length | 51.78 Number of splices: Total | 253221 Number of splices: Annotated (sjdb) | 249800 Number of splices: GT/AG | 247432 Number of splices: GC/AG | 4559 Number of splices: AT/AC | 417 Number of splices: Non-canonical | 813 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370018 % of reads mapped to multiple loci | 11.53% Number of reads mapped to too many loci | 104516 % of reads mapped to too many loci | 3.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 188547 188547 188547 N_multimapping 370018 370018 370018 N_noFeature 496807 2593800 544422 N_ambiguous 19873 144 10364 UnstrandedReadsAssigned:2134115 PositiveStrandReadsAssigned:56851 NegativeStrandReadsAssigned:2096009 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423319 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423319-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,209,360 reads, 2,382,022 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR5423319.ke.tsv 34699 SRR5423319.se.tsv 87100 total ==> SRR5423319.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 68 15.2966 Potri.005G024800.1.v4.1 1035 936 3 1.38359 Potri.004G059700.1.v4.1 961 862 3 1.50237 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.1568 5.4881 Potri.016G087400.1.v4.1 270 171 17 42.9155 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 22 10.8166 ==> SRR5423319.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 28 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423319 completed mapping pipeline successfully