Starting /dee2/code/volunteer_pipeline.sh SRR5423320 current disk space = 3050080878592 free memory = 1298984208 SRR5423320 SRAfilesize 20bf10bc363dec6004a499306192662d SRR5423320.sra SRR5423320.sra file validated SRR5423320 is single end SRR5423320 is conventional basespace SRR5423320 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423320_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.68075 16.0 16.0 27.0 16.0 30.0 2 23.0095 25.0 16.0 30.0 16.0 30.0 3 24.2005 27.0 16.0 30.0 16.0 31.0 4 29.0735 32.0 19.0 35.0 19.0 35.0 5 23.2735 19.0 19.0 32.0 10.0 35.0 6 22.0815 17.0 17.0 31.0 10.0 33.0 7 23.1525 25.0 17.0 32.0 10.0 35.0 8 24.23075 27.0 17.0 32.0 11.0 35.0 9 23.90975 27.0 17.0 32.0 10.0 35.0 10 26.177 28.0 17.0 33.0 15.0 35.0 11 27.00475 30.0 17.0 34.0 15.0 35.0 12 25.76875 27.0 17.0 34.0 11.0 35.0 13 26.3585 29.0 17.0 34.0 11.0 35.0 14 26.98275 30.0 18.0 34.0 11.0 36.0 15 28.2415 32.0 25.0 34.0 16.0 37.0 16 27.90725 31.0 24.0 34.0 16.0 37.0 17 27.94475 31.0 24.0 35.0 11.0 37.0 18 24.9055 27.0 17.0 32.0 10.0 36.0 19 26.7865 30.0 18.0 34.0 11.0 37.0 20 26.273 27.0 18.0 34.0 10.0 37.0 21 26.73175 30.0 18.0 34.0 10.0 37.0 22 26.45975 30.0 18.0 34.0 10.0 37.0 23 25.30225 27.0 18.0 33.0 10.0 36.0 24 25.23425 27.0 18.0 32.0 10.0 36.0 25 24.22 27.0 17.0 32.0 10.0 36.0 26 20.60125 18.0 10.0 30.0 8.0 34.0 27 20.38875 18.0 10.0 30.0 8.0 34.0 28 21.34425 23.0 10.0 30.0 9.0 34.0 29 22.273 24.0 14.0 31.0 9.0 34.0 30 22.849 25.0 15.0 31.0 8.0 35.0 31 23.2445 25.0 15.0 31.0 9.0 35.0 32 19.07725 16.0 9.0 29.0 8.0 34.0 33 20.26375 18.0 9.0 30.0 8.0 34.0 34 21.49225 24.0 12.0 30.0 8.0 34.0 35 21.245 24.0 9.0 30.0 8.0 35.0 36 19.84475 17.0 9.0 30.0 8.0 34.0 37 19.746 17.0 9.0 30.0 8.0 34.0 38 19.23325 16.0 9.0 29.0 8.0 33.0 39 19.79125 18.0 9.0 30.0 8.0 33.0 40 19.96275 19.0 9.0 30.0 8.0 33.0 41 21.2085 23.0 12.0 30.0 8.0 34.0 42 20.70725 22.0 9.0 30.0 8.0 33.0 43 21.22675 23.0 10.0 30.0 8.0 35.0 44 21.162 23.0 10.0 30.0 8.0 34.0 45 20.223 21.0 9.0 30.0 8.0 33.0 46 19.34175 19.0 9.0 29.0 7.0 33.0 47 19.4895 19.0 9.0 28.0 7.0 33.0 48 19.717 20.0 9.0 28.0 7.0 33.0 49 18.75175 18.0 9.0 28.0 7.0 33.0 50 18.38125 15.0 9.0 27.0 7.0 32.0 51 16.5295 13.0 8.0 24.0 7.0 31.0 52 16.75275 14.0 8.0 24.0 7.0 30.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 12 1.0 13 5.0 14 19.0 15 27.0 16 82.0 17 128.0 18 201.0 19 287.0 20 399.0 21 474.0 22 521.0 23 491.0 24 425.0 25 384.0 26 220.0 27 167.0 28 106.0 29 47.0 30 11.0 31 3.0 32 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.713713713713716 12.837837837837837 6.781781781781781 41.66666666666667 2 24.275 12.975 37.375 25.374999999999996 3 20.0 17.375 25.324999999999996 37.3 4 22.85 24.375 21.275 31.5 5 36.3 26.900000000000002 10.100000000000001 26.700000000000003 6 20.525 30.599999999999998 25.3 23.575 7 18.2 19.650000000000002 41.325 20.825 8 16.8 21.65 30.825000000000003 30.725 9 20.349999999999998 18.725 33.95 26.974999999999998 10 20.549999999999997 32.0 24.3 23.150000000000002 11 21.95 22.75 24.4 30.9 12 18.6 21.349999999999998 30.175 29.875 13 23.375 23.75 27.224999999999998 25.650000000000002 14 20.775 21.975 29.175 28.075 15 21.775 22.3 28.549999999999997 27.375 16 20.674999999999997 23.974999999999998 26.6 28.749999999999996 17 21.0 22.975 27.975 28.050000000000004 18 21.425 25.974999999999998 26.75 25.85 19 22.400000000000002 23.825 27.200000000000003 26.575 20 22.675 24.85 25.4 27.075 21 22.575 22.725 25.775 28.925 22 19.325 26.224999999999998 25.874999999999996 28.575 23 22.400000000000002 24.075 25.724999999999998 27.800000000000004 24 21.525 27.55 24.625 26.3 25 22.125 26.25 25.3 26.325 26 23.875 24.775 26.625 24.725 27 23.45 25.674999999999997 25.5 25.374999999999996 28 22.875 26.450000000000003 23.275000000000002 27.400000000000002 29 20.875 27.775 24.875 26.474999999999998 30 23.05 25.374999999999996 27.55 24.025 31 23.150000000000002 23.75 25.825 27.275 32 23.674999999999997 27.750000000000004 23.125 25.45 33 22.775000000000002 27.85 25.474999999999998 23.9 34 18.675 25.650000000000002 26.900000000000002 28.775000000000002 35 22.1 26.85 26.575 24.474999999999998 36 22.075 27.05 24.375 26.5 37 23.225 24.9 24.099999999999998 27.775 38 21.475 25.85 24.825 27.85 39 22.875 24.2 26.025 26.900000000000002 40 21.5 27.55 25.474999999999998 25.474999999999998 41 22.400000000000002 25.775 22.15 29.675 42 22.325 23.825 25.15 28.7 43 21.45 26.5 26.025 26.025 44 24.175 23.3 23.625 28.9 45 21.0 26.150000000000002 25.7 27.150000000000002 46 22.7 24.425 25.025 27.85 47 21.425 26.25 24.7 27.625 48 20.75 26.125 27.3 25.825 49 24.025 26.700000000000003 24.625 24.65 50 24.725 26.075 24.275 24.925 51 23.25 26.75 23.724999999999998 26.275 52 22.650000000000002 29.7 22.925 24.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 4.0 15 5.0 16 4.0 17 3.0 18 1.5 19 0.0 20 1.0 21 2.0 22 2.5 23 3.0 24 10.5 25 18.0 26 24.5 27 31.0 28 34.5 29 38.0 30 46.5 31 55.0 32 68.0 33 81.0 34 94.0 35 107.0 36 123.5 37 140.0 38 153.5 39 180.5 40 194.0 41 235.0 42 276.0 43 292.0 44 308.0 45 291.5 46 275.0 47 285.0 48 295.0 49 279.5 50 264.0 51 272.5 52 281.0 53 265.0 54 249.0 55 234.5 56 220.0 57 204.5 58 189.0 59 187.0 60 185.0 61 154.5 62 124.0 63 116.0 64 92.0 65 76.0 66 68.0 67 60.0 68 63.5 69 67.0 70 59.0 71 51.0 72 47.5 73 44.0 74 35.0 75 26.0 76 24.0 77 22.0 78 19.0 79 16.0 80 12.0 81 8.0 82 6.0 83 4.0 84 3.5 85 3.0 86 2.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16624557857504 98.125 2 0.631632137443153 1.25 3 0.17685699848408287 0.525 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra Read 11142 spots for SRR5423320.sra Written 11142 spots for SRR5423320.sra Read 11131 spots for SRR5423320.sra Written 11131 spots for SRR5423320.sra SRR ids: ['SRR5423320.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5orer4io SRR5423320.sra spots: 222631 blocks: [[1, 11131], [11132, 22262], [22263, 33393], [33394, 44524], [44525, 55655], [55656, 66786], [66787, 77917], [77918, 89048], [89049, 100179], [100180, 111310], [111311, 122441], [122442, 133572], [133573, 144703], [144704, 155834], [155835, 166965], [166966, 178096], [178097, 189227], [189228, 200358], [200359, 211489], [211490, 222631]] SRR5423320 file size 38912 SRR5423320 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423320 SRR5423320_1.fastq Input file: SRR5423320_1.fastq trimmed: SRR5423320-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:01:53 2025 >> started Wed Feb 12 07:01:53 2025 >> done (0.170s) 222631 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 222624 (100.00%) reads available; of these: 47637 (21.40%) trimmed reads available after processing 174987 (78.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 36 1 0.00% 37 1 0.00% 38 1 0.00% 39 3 0.00% 40 5 0.00% 41 7 0.00% 42 19 0.01% 43 31 0.01% 44 49 0.02% 45 80 0.04% 46 175 0.08% 47 351 0.16% 48 1001 0.45% 49 2509 1.13% 50 9106 4.09% 51 34298 15.41% 52 174987 78.60% 222624 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=9 prefix-density=0.12 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=4.52 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=1.0 sequence=TCTCGTAGTTCTTGGTCTGTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA Started job on | Feb 12 07:02:06 Started mapping on | Feb 12 07:02:07 Finished on | Feb 12 07:02:18 Mapping speed, Million of reads per hour | 72.86 Number of input reads | 222624 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 164725 Uniquely mapped reads % | 73.99% Average mapped length | 51.24 Number of splices: Total | 13514 Number of splices: Annotated (sjdb) | 13284 Number of splices: GT/AG | 13242 Number of splices: GC/AG | 240 Number of splices: AT/AC | 11 Number of splices: Non-canonical | 21 Mismatch rate per base, % | 3.15% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 25022 % of reads mapped to multiple loci | 11.24% Number of reads mapped to too many loci | 6484 % of reads mapped to too many loci | 2.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.84% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 32877 32877 32877 N_multimapping 25022 25022 25022 N_noFeature 30897 161277 33707 N_ambiguous 1431 11 782 UnstrandedReadsAssigned:132397 PositiveStrandReadsAssigned:3437 NegativeStrandReadsAssigned:130236 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423320 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423320-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 222,624 reads, 98,659 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 736 rounds 52401 SRR5423320.ke.tsv 34699 SRR5423320.se.tsv 87100 total ==> SRR5423320.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 10 55.0972 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 9.83518 36.5643 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR5423320.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423320 completed mapping pipeline successfully