Starting /dee2/code/volunteer_pipeline.sh SRR5423321 current disk space = 3050288463872 free memory = 1509521848 SRR5423321 SRAfilesize d93da23b2f46e682cde4e4fc6c023fb2 SRR5423321.sra SRR5423321.sra file validated SRR5423321 is single end SRR5423321 is conventional basespace SRR5423321 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423321_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.454 34.0 31.0 34.0 31.0 34.0 2 32.6435 34.0 31.0 34.0 31.0 34.0 3 32.691 34.0 31.0 34.0 31.0 34.0 4 36.14325 37.0 37.0 37.0 35.0 37.0 5 36.05025 37.0 35.0 37.0 35.0 37.0 6 36.05175 37.0 35.0 37.0 35.0 37.0 7 36.10775 37.0 36.0 37.0 35.0 37.0 8 35.956 37.0 35.0 37.0 35.0 37.0 9 37.94075 39.0 38.0 39.0 35.0 39.0 10 37.844 39.0 38.0 39.0 35.0 39.0 11 37.919 39.0 38.0 39.0 35.0 39.0 12 37.9025 39.0 38.0 39.0 35.0 39.0 13 37.9145 39.0 38.0 39.0 35.0 39.0 14 39.42575 41.0 39.0 41.0 36.0 41.0 15 39.26175 41.0 39.0 41.0 36.0 41.0 16 39.15575 40.0 39.0 41.0 36.0 41.0 17 39.15825 40.0 39.0 41.0 36.0 41.0 18 39.15075 40.0 39.0 41.0 36.0 41.0 19 39.11475 40.0 39.0 41.0 36.0 41.0 20 38.88525 40.0 38.0 41.0 35.0 41.0 21 38.9185 40.0 39.0 41.0 35.0 41.0 22 38.93525 40.0 39.0 41.0 35.0 41.0 23 38.8965 40.0 38.0 41.0 35.0 41.0 24 38.7505 40.0 38.0 41.0 34.0 41.0 25 38.699 40.0 38.0 41.0 34.0 41.0 26 38.5125 40.0 38.0 41.0 34.0 41.0 27 38.533 40.0 38.0 41.0 34.0 41.0 28 38.46125 40.0 38.0 41.0 34.0 41.0 29 38.29125 40.0 38.0 41.0 34.0 41.0 30 38.1735 40.0 38.0 41.0 34.0 41.0 31 38.254 40.0 38.0 41.0 33.0 41.0 32 38.11925 40.0 38.0 41.0 33.0 41.0 33 37.9775 40.0 38.0 41.0 33.0 41.0 34 37.95025 40.0 38.0 41.0 32.0 41.0 35 37.85475 40.0 38.0 41.0 33.0 41.0 36 37.699 40.0 38.0 41.0 32.0 41.0 37 37.66275 40.0 38.0 41.0 31.0 41.0 38 37.64275 40.0 38.0 41.0 32.0 41.0 39 37.3445 40.0 37.0 41.0 31.0 41.0 40 37.34175 40.0 37.0 41.0 31.0 41.0 41 37.30975 40.0 37.0 41.0 31.0 41.0 42 37.2525 40.0 37.0 41.0 30.0 41.0 43 37.17525 40.0 37.0 41.0 30.0 41.0 44 36.967 40.0 37.0 41.0 30.0 41.0 45 36.689 40.0 36.0 41.0 29.0 41.0 46 36.555 40.0 36.0 41.0 28.0 41.0 47 36.57025 40.0 36.0 41.0 29.0 41.0 48 36.52625 40.0 36.0 41.0 28.0 41.0 49 36.22525 39.0 35.0 41.0 28.0 41.0 50 36.18 39.0 35.0 41.0 27.0 41.0 51 35.77675 39.0 35.0 40.0 26.0 41.0 52 33.77575 38.0 32.0 40.0 21.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1201 1 0.0 1201 2 0.0 1201 3 0.0 1201 4 0.0 1201 5 0.0 1201 6 0.0 1201 7 0.0 1201 8 0.0 1201 9 0.0 1201 10 0.0 1201 11 0.0 1201 12 0.0 1201 13 0.0 1201 14 0.0 1201 15 0.0 1201 16 0.0 1201 17 0.0 1201 18 0.0 1201 19 0.0 1201 20 0.0 1201 21 0.0 1201 22 0.0 1201 23 0.0 1201 24 0.0 1201 25 0.0 1201 26 0.0 1201 27 0.0 1201 28 0.0 1201 29 0.0 1201 30 0.0 1201 31 0.0 1201 32 0.0 1201 33 0.0 1201 34 0.0 1201 35 0.0 1201 36 0.0 1201 37 0.0 1201 38 0.0 1201 39 0.0 1201 40 0.0 1201 41 0.0 1201 42 0.0 1201 43 0.0 1201 44 0.0 1201 45 0.0 1201 46 0.0 1201 47 0.0 1201 48 0.0 1201 49 0.0 1201 50 0.0 1201 51 0.0 1201 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 14.0 23 17.0 24 17.0 25 16.0 26 33.0 27 26.0 28 31.0 29 48.0 30 58.0 31 72.0 32 79.0 33 107.0 34 135.0 35 190.0 36 252.0 37 385.0 38 703.0 39 1805.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.276035131744045 10.865746549560853 5.370138017565872 43.48808030112924 2 22.900000000000002 13.3 35.525 28.275 3 21.5 17.325 25.724999999999998 35.449999999999996 4 25.55 25.124999999999996 22.075 27.250000000000004 5 24.975 30.125 24.0 20.9 6 18.099999999999998 33.025 24.975 23.9 7 14.524999999999999 22.85 41.55 21.075 8 18.3 22.525000000000002 30.375000000000004 28.799999999999997 9 18.775 20.125 34.325 26.775 10 17.825 36.75 23.825 21.6 11 23.45 27.85 22.025 26.674999999999997 12 21.875 23.35 26.775 28.000000000000004 13 20.275000000000002 25.55 27.6 26.575 14 20.599999999999998 25.624999999999996 28.65 25.124999999999996 15 19.85 26.35 27.250000000000004 26.55 16 20.775 25.275 26.700000000000003 27.250000000000004 17 22.325 26.525 26.474999999999998 24.675 18 21.5 25.974999999999998 26.924999999999997 25.6 19 20.349999999999998 26.575 26.6 26.474999999999998 20 21.825 26.3 26.900000000000002 24.975 21 21.275 26.625 25.474999999999998 26.625 22 22.7 26.825 25.825 24.65 23 23.175 26.6 24.2 26.025 24 21.525 25.275 26.25 26.950000000000003 25 21.3 26.474999999999998 25.650000000000002 26.575 26 22.0 26.1 26.424999999999997 25.474999999999998 27 21.85 26.150000000000002 25.5 26.5 28 21.55 26.0 25.575 26.875 29 20.775 26.224999999999998 26.700000000000003 26.3 30 21.625 24.525 27.325 26.525 31 22.0 25.35 26.3 26.35 32 22.775000000000002 26.150000000000002 26.275 24.8 33 21.5 25.474999999999998 26.700000000000003 26.325 34 20.025000000000002 26.674999999999997 26.450000000000003 26.85 35 22.125 24.525 26.0 27.35 36 20.275000000000002 26.275 25.45 28.000000000000004 37 20.875 25.525 25.55 28.050000000000004 38 22.825 24.85 26.35 25.974999999999998 39 21.875 25.05 25.974999999999998 27.1 40 21.65 25.924999999999997 26.375 26.05 41 22.25 25.2 26.174999999999997 26.375 42 22.2 25.0 27.250000000000004 25.55 43 24.825 24.675 24.425 26.075 44 23.474999999999998 25.924999999999997 24.675 25.924999999999997 45 22.875 24.65 26.075 26.400000000000002 46 22.375 25.174999999999997 25.724999999999998 26.724999999999998 47 24.4 25.900000000000002 25.0 24.7 48 23.35 26.125 24.275 26.25 49 21.25 26.05 25.3 27.400000000000002 50 23.849999999999998 25.575 25.05 25.525 51 22.175 25.0 25.224999999999998 27.6 52 24.0 25.275 23.75 26.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 3.0 19 5.0 20 5.5 21 6.0 22 7.0 23 8.0 24 9.5 25 11.0 26 22.0 27 33.0 28 31.5 29 30.0 30 39.0 31 48.0 32 61.5 33 75.0 34 83.5 35 92.0 36 113.5 37 135.0 38 144.0 39 183.0 40 213.0 41 239.0 42 265.0 43 285.0 44 305.0 45 306.0 46 307.0 47 322.5 48 338.0 49 355.0 50 372.0 51 355.5 52 339.0 53 321.0 54 303.0 55 280.0 56 257.0 57 233.5 58 210.0 59 173.0 60 136.0 61 125.0 62 114.0 63 90.5 64 61.5 65 56.0 66 44.0 67 32.0 68 27.5 69 23.0 70 24.0 71 25.0 72 17.0 73 9.0 74 9.0 75 9.0 76 8.0 77 7.0 78 6.0 79 5.0 80 3.5 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 2.0 92 4.0 93 2.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 97.0164878304109 92.675 2 2.1198639099712118 4.05 3 0.44490970950013087 1.275 4 0.20936927505888508 0.8 5 0.10468463752944254 0.5 6 0.026171159382360636 0.15 7 0.05234231876472127 0.35000000000000003 8 0.026171159382360636 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGACTCCAACTATCGTCCATGTACGATCCATACTAGATCTGACCAACTGC 8 0.2 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 7 0.17500000000000002 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 5 0.125 No Hit GTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCG 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra Read 200000 spots for SRR5423321.sra Written 200000 spots for SRR5423321.sra SRR ids: ['SRR5423321.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x7_mull8 SRR5423321.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423321 file size 703975 SRR5423321 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423321 SRR5423321_1.fastq Input file: SRR5423321_1.fastq trimmed: SRR5423321-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:53:33 2025 >> started Wed Feb 12 06:53:36 2025 >> done (2.526s) 4000000 reads processed; of these: 123 ( 0.00%) short reads filtered out after trimming by size control 80 ( 0.00%) empty reads filtered out after trimming by size control 3999797 (99.99%) reads available; of these: 129779 ( 3.24%) trimmed reads available after processing 3870018 (96.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 6 0.00% 23 3 0.00% 24 15 0.00% 25 13 0.00% 26 11 0.00% 27 27 0.00% 28 14 0.00% 29 16 0.00% 30 27 0.00% 31 34 0.00% 32 43 0.00% 33 57 0.00% 34 75 0.00% 35 85 0.00% 36 90 0.00% 37 108 0.00% 38 147 0.00% 39 204 0.01% 40 230 0.01% 41 262 0.01% 42 407 0.01% 43 397 0.01% 44 818 0.02% 45 1112 0.03% 46 1425 0.04% 47 1953 0.05% 48 3278 0.08% 49 6557 0.16% 50 17569 0.44% 51 94780 2.37% 52 3870018 96.76% 3999797 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=19.72 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.3 sequence=CTTGAGTTCATTTGCTTTTGATTTAATATGGTATCGATAGCAATAGCTGTTTTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTTA Started job on | Feb 12 06:53:49 Started mapping on | Feb 12 06:53:49 Finished on | Feb 12 06:53:55 Mapping speed, Million of reads per hour | 2399.88 Number of input reads | 3999797 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305752 Uniquely mapped reads % | 82.65% Average mapped length | 51.75 Number of splices: Total | 318650 Number of splices: Annotated (sjdb) | 314212 Number of splices: GT/AG | 311193 Number of splices: GC/AG | 5930 Number of splices: AT/AC | 496 Number of splices: Non-canonical | 1031 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463262 % of reads mapped to multiple loci | 11.58% Number of reads mapped to too many loci | 120897 % of reads mapped to too many loci | 3.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230783 230783 230783 N_multimapping 463262 463262 463262 N_noFeature 614268 3234448 673724 N_ambiguous 25168 180 13161 UnstrandedReadsAssigned:2666316 PositiveStrandReadsAssigned:71124 NegativeStrandReadsAssigned:2618867 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423321 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423321-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,797 reads, 2,974,468 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR5423321.ke.tsv 34699 SRR5423321.se.tsv 87100 total ==> SRR5423321.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 100 18.0028 Potri.005G024800.1.v4.1 1035 936 1 0.369096 Potri.004G059700.1.v4.1 961 862 4 1.60313 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 53.3295 6.47819 Potri.016G087400.1.v4.1 270 171 22 44.4469 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 30 11.8043 ==> SRR5423321.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 42 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423321 completed mapping pipeline successfully