Starting /dee2/code/volunteer_pipeline.sh SRR5423322 current disk space = 3049997295616 free memory = 1576361300 SRR5423322 SRAfilesize 0861f481ddca7687a3160de8b797aaf4 SRR5423322.sra SRR5423322.sra file validated SRR5423322 is single end SRR5423322 is conventional basespace SRR5423322 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423322_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9765 33.0 31.0 34.0 30.0 34.0 2 32.1365 34.0 31.0 34.0 30.0 34.0 3 32.1535 34.0 31.0 34.0 30.0 34.0 4 35.256 37.0 35.0 37.0 32.0 37.0 5 35.65875 37.0 35.0 37.0 33.0 37.0 6 35.823 37.0 35.0 37.0 35.0 37.0 7 35.77175 37.0 35.0 37.0 35.0 37.0 8 35.712 37.0 35.0 37.0 33.0 37.0 9 37.227 39.0 37.0 39.0 33.0 39.0 10 37.27825 39.0 37.0 39.0 33.0 39.0 11 37.2975 39.0 37.0 39.0 34.0 39.0 12 37.4325 39.0 37.0 39.0 35.0 39.0 13 37.32925 39.0 37.0 39.0 34.0 39.0 14 38.624 40.0 38.0 41.0 34.0 41.0 15 38.44575 40.0 38.0 41.0 33.0 41.0 16 38.56425 40.0 38.0 41.0 34.0 41.0 17 38.55275 40.0 38.0 41.0 34.0 41.0 18 38.61825 40.0 38.0 41.0 34.0 41.0 19 38.62125 40.0 38.0 41.0 34.0 41.0 20 38.613 40.0 38.0 41.0 34.0 41.0 21 38.573 40.0 38.0 41.0 34.0 41.0 22 38.59475 40.0 38.0 41.0 34.0 41.0 23 38.40875 40.0 38.0 41.0 34.0 41.0 24 38.3675 40.0 38.0 41.0 33.0 41.0 25 38.406 40.0 38.0 41.0 34.0 41.0 26 38.302 40.0 38.0 41.0 34.0 41.0 27 38.2765 40.0 38.0 41.0 34.0 41.0 28 38.212 40.0 38.0 41.0 33.0 41.0 29 38.133 40.0 38.0 41.0 33.0 41.0 30 38.095 40.0 38.0 41.0 33.0 41.0 31 37.955 40.0 37.0 41.0 33.0 41.0 32 37.89075 40.0 37.0 41.0 33.0 41.0 33 37.912 40.0 37.0 41.0 33.0 41.0 34 37.89675 40.0 37.0 41.0 33.0 41.0 35 37.921 40.0 37.0 41.0 33.0 41.0 36 37.83725 40.0 37.0 41.0 33.0 41.0 37 37.89225 40.0 37.0 41.0 33.0 41.0 38 37.75775 40.0 37.0 41.0 32.0 41.0 39 37.72725 40.0 37.0 41.0 33.0 41.0 40 37.53775 40.0 37.0 41.0 31.0 41.0 41 37.499 40.0 37.0 41.0 31.0 41.0 42 37.55075 40.0 37.0 41.0 32.0 41.0 43 37.378 40.0 36.0 41.0 31.0 41.0 44 36.99675 39.0 36.0 41.0 30.0 41.0 45 37.22375 40.0 36.0 41.0 31.0 41.0 46 36.98425 39.0 36.0 41.0 30.0 41.0 47 36.8505 39.0 36.0 41.0 30.0 41.0 48 36.90925 39.0 35.0 41.0 30.0 41.0 49 36.85675 39.0 35.0 41.0 30.0 41.0 50 36.68725 39.0 35.0 41.0 30.0 41.0 51 36.60025 39.0 35.0 41.0 29.0 41.0 52 35.313 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1209 1 0.0 1209 2 0.0 1209 3 0.0 1209 4 0.0 1209 5 0.0 1209 6 0.0 1209 7 0.0 1209 8 0.0 1209 9 0.0 1209 10 0.0 1209 11 0.0 1209 12 0.0 1209 13 0.0 1209 14 0.0 1209 15 0.0 1209 16 0.0 1209 17 0.0 1209 18 0.0 1209 19 0.0 1209 20 0.0 1209 21 0.0 1209 22 0.0 1209 23 0.0 1209 24 0.0 1209 25 0.0 1209 26 0.0 1209 27 0.0 1209 28 0.0 1209 29 0.0 1209 30 0.0 1209 31 0.0 1209 32 0.0 1209 33 0.0 1209 34 0.0 1209 35 0.0 1209 36 0.0 1209 37 0.0 1209 38 0.0 1209 39 0.0 1209 40 0.0 1209 41 0.0 1209 42 0.0 1209 43 0.0 1209 44 0.0 1209 45 0.0 1209 46 0.0 1209 47 0.0 1209 48 0.0 1209 49 0.0 1209 50 0.0 1209 51 0.0 1209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 0.0 21 2.0 22 8.0 23 6.0 24 4.0 25 15.0 26 13.0 27 22.0 28 43.0 29 53.0 30 67.0 31 68.0 32 109.0 33 144.0 34 169.0 35 265.0 36 289.0 37 440.0 38 742.0 39 1534.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.28986960882648 10.907723169508525 5.892678034102307 44.90972918756269 2 23.599999999999998 14.725 34.449999999999996 27.224999999999998 3 21.825 18.425 24.075 35.675000000000004 4 26.1 25.775 21.349999999999998 26.775 5 24.474999999999998 30.775000000000002 24.375 20.375 6 18.4 32.85 25.025 23.724999999999998 7 16.25 22.025 41.375 20.349999999999998 8 16.325 22.175 32.0 29.5 9 18.6 20.45 34.425 26.525 10 18.525 35.8 25.0 20.674999999999997 11 23.65 26.674999999999997 21.675 28.000000000000004 12 21.55 24.775 26.125 27.55 13 20.95 26.75 26.3 26.0 14 19.525000000000002 28.225 27.85 24.4 15 21.099999999999998 26.55 26.525 25.825 16 21.825 26.55 26.25 25.374999999999996 17 21.349999999999998 26.5 27.275 24.875 18 21.9 25.275 27.700000000000003 25.124999999999996 19 21.625 25.924999999999997 25.924999999999997 26.525 20 21.349999999999998 26.05 26.625 25.974999999999998 21 21.675 27.3 25.45 25.575 22 20.825 26.8 25.124999999999996 27.250000000000004 23 21.7 26.1 26.75 25.45 24 23.1 26.1 24.325 26.474999999999998 25 21.224999999999998 27.175 25.474999999999998 26.125 26 22.1 27.125 25.724999999999998 25.05 27 22.175 26.0 25.025 26.8 28 22.6 25.45 26.55 25.4 29 21.075 25.85 27.55 25.525 30 21.275 24.25 26.700000000000003 27.775 31 21.025 26.05 27.325 25.6 32 21.95 25.650000000000002 26.0 26.400000000000002 33 20.9 26.75 25.174999999999997 27.175 34 21.65 25.7 27.0 25.650000000000002 35 21.224999999999998 25.124999999999996 26.724999999999998 26.924999999999997 36 21.875 25.900000000000002 24.925 27.3 37 20.849999999999998 25.874999999999996 25.775 27.500000000000004 38 21.75 25.874999999999996 27.175 25.2 39 21.7 25.575 25.650000000000002 27.075 40 21.5 25.275 26.3 26.924999999999997 41 22.125 26.05 25.575 26.25 42 22.15 24.675 26.950000000000003 26.224999999999998 43 23.175 25.174999999999997 25.275 26.375 44 21.95 25.6 25.874999999999996 26.575 45 22.475 24.349999999999998 25.224999999999998 27.950000000000003 46 23.0 24.6 24.95 27.450000000000003 47 22.55 26.0 25.900000000000002 25.55 48 23.200000000000003 24.925 26.075 25.8 49 21.925 25.25 26.474999999999998 26.35 50 22.775000000000002 24.525 25.924999999999997 26.775 51 22.1 25.374999999999996 25.650000000000002 26.875 52 23.325000000000003 25.224999999999998 24.75 26.700000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 3.5 19 6.0 20 6.5 21 7.0 22 8.0 23 9.0 24 10.0 25 11.0 26 14.5 27 18.0 28 26.0 29 34.0 30 40.5 31 47.0 32 67.0 33 87.0 34 96.5 35 106.0 36 119.5 37 133.0 38 162.5 39 205.0 40 218.0 41 240.5 42 263.0 43 283.0 44 303.0 45 314.5 46 326.0 47 335.0 48 344.0 49 328.0 50 312.0 51 308.0 52 304.0 53 308.5 54 313.0 55 263.5 56 214.0 57 217.5 58 221.0 59 183.0 60 145.0 61 136.5 62 128.0 63 105.0 64 70.0 65 58.0 66 52.0 67 46.0 68 31.5 69 17.0 70 17.5 71 18.0 72 17.0 73 16.0 74 11.0 75 6.0 76 6.0 77 6.0 78 5.0 79 4.0 80 2.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.69291338582677 92.10000000000001 2 2.388451443569554 4.55 3 0.5249343832020997 1.5 4 0.2099737532808399 0.8 5 0.07874015748031496 0.375 6 0.07874015748031496 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.026246719160104987 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 9 0.22499999999999998 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 6 0.15 No Hit GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 6 0.15 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit GGAGACGATGGGGTCGGTCCATGGATTTTCCTTCCTTTTTCCGCATTTCGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra Read 200000 spots for SRR5423322.sra Written 200000 spots for SRR5423322.sra SRR ids: ['SRR5423322.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8el3o9e SRR5423322.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423322 file size 703943 SRR5423322 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423322 SRR5423322_1.fastq Input file: SRR5423322_1.fastq trimmed: SRR5423322-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:15:36 2025 >> started Wed Feb 12 07:15:38 2025 >> done (2.559s) 4000000 reads processed; of these: 119 ( 0.00%) short reads filtered out after trimming by size control 71 ( 0.00%) empty reads filtered out after trimming by size control 3999810 (100.00%) reads available; of these: 84631 ( 2.12%) trimmed reads available after processing 3915179 (97.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 0 0.00% 28 3 0.00% 29 8 0.00% 30 4 0.00% 31 7 0.00% 32 14 0.00% 33 15 0.00% 34 32 0.00% 35 29 0.00% 36 31 0.00% 37 38 0.00% 38 47 0.00% 39 38 0.00% 40 53 0.00% 41 80 0.00% 42 124 0.00% 43 143 0.00% 44 228 0.01% 45 332 0.01% 46 447 0.01% 47 739 0.02% 48 1486 0.04% 49 3353 0.08% 50 10010 0.25% 51 67341 1.68% 52 3915179 97.88% 3999810 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=24.63 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:15:49 Started mapping on | Feb 12 07:15:49 Finished on | Feb 12 07:15:56 Mapping speed, Million of reads per hour | 2057.05 Number of input reads | 3999810 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3303623 Uniquely mapped reads % | 82.59% Average mapped length | 51.78 Number of splices: Total | 317174 Number of splices: Annotated (sjdb) | 312780 Number of splices: GT/AG | 309957 Number of splices: GC/AG | 5737 Number of splices: AT/AC | 463 Number of splices: Non-canonical | 1017 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461817 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 129305 % of reads mapped to too many loci | 3.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 234370 234370 234370 N_multimapping 461817 461817 461817 N_noFeature 619930 3233089 678532 N_ambiguous 25219 172 13132 UnstrandedReadsAssigned:2658474 PositiveStrandReadsAssigned:70362 NegativeStrandReadsAssigned:2611959 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423322 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423322-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,810 reads, 2,961,933 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR5423322.ke.tsv 34699 SRR5423322.se.tsv 87100 total ==> SRR5423322.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 93 16.8467 Potri.005G024800.1.v4.1 1035 936 1 0.37139 Potri.004G059700.1.v4.1 961 862 4 1.61309 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 58.1934 7.11295 Potri.016G087400.1.v4.1 270 171 24 48.7889 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.207659 Potri.012G127500.1.v4.1 977 878 29 11.4818 ==> SRR5423322.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 39 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423322 completed mapping pipeline successfully