Starting /dee2/code/volunteer_pipeline.sh SRR5423323 current disk space = 3049899986944 free memory = 1577811032 SRR5423323 SRAfilesize 488cb04900712b1dde488710c74ca72f SRR5423323.sra SRR5423323.sra file validated SRR5423323 is single end SRR5423323 is conventional basespace SRR5423323 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423323_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4605 34.0 31.0 34.0 30.0 34.0 2 32.58 34.0 31.0 34.0 31.0 34.0 3 32.61925 34.0 31.0 34.0 31.0 34.0 4 36.04475 37.0 35.0 37.0 35.0 37.0 5 35.95975 37.0 35.0 37.0 35.0 37.0 6 35.98075 37.0 35.0 37.0 35.0 37.0 7 35.95325 37.0 35.0 37.0 35.0 37.0 8 36.05525 37.0 35.0 37.0 35.0 37.0 9 37.849 39.0 38.0 39.0 35.0 39.0 10 37.72875 39.0 38.0 39.0 35.0 39.0 11 37.709 39.0 37.0 39.0 35.0 39.0 12 37.6575 39.0 38.0 39.0 35.0 39.0 13 37.66375 39.0 38.0 39.0 35.0 39.0 14 39.1055 40.0 39.0 41.0 36.0 41.0 15 38.842 40.0 38.0 41.0 35.0 41.0 16 38.96175 40.0 38.0 41.0 36.0 41.0 17 38.89775 40.0 38.0 41.0 35.0 41.0 18 38.82075 40.0 38.0 41.0 35.0 41.0 19 38.86725 40.0 38.0 41.0 34.0 41.0 20 38.7545 40.0 38.0 41.0 35.0 41.0 21 38.76325 40.0 38.0 41.0 34.0 41.0 22 38.6985 40.0 38.0 41.0 34.0 41.0 23 38.547 40.0 38.0 41.0 34.0 41.0 24 38.52375 40.0 38.0 41.0 34.0 41.0 25 38.36575 40.0 38.0 41.0 34.0 41.0 26 38.33825 40.0 38.0 41.0 34.0 41.0 27 38.3255 40.0 38.0 41.0 34.0 41.0 28 38.165 40.0 38.0 41.0 33.0 41.0 29 38.0435 40.0 38.0 41.0 33.0 41.0 30 37.88225 40.0 38.0 41.0 32.0 41.0 31 37.99675 40.0 38.0 41.0 33.0 41.0 32 37.863 40.0 38.0 41.0 32.0 41.0 33 37.74725 40.0 38.0 41.0 32.0 41.0 34 37.633 40.0 37.0 41.0 31.0 41.0 35 37.585 40.0 37.0 41.0 31.0 41.0 36 37.59375 40.0 37.0 41.0 31.0 41.0 37 37.48225 40.0 37.0 41.0 31.0 41.0 38 37.20325 40.0 37.0 41.0 31.0 41.0 39 37.11525 40.0 37.0 41.0 30.0 41.0 40 36.97025 40.0 37.0 41.0 30.0 41.0 41 37.12525 40.0 37.0 41.0 30.0 41.0 42 36.92925 40.0 37.0 41.0 30.0 41.0 43 36.49825 40.0 36.0 41.0 28.0 41.0 44 36.5215 40.0 36.0 41.0 29.0 41.0 45 36.578 40.0 36.0 41.0 29.0 41.0 46 36.5905 40.0 36.0 41.0 29.0 41.0 47 36.378 39.0 36.0 41.0 28.0 41.0 48 36.17375 39.0 35.0 41.0 28.0 41.0 49 36.136 39.0 35.0 41.0 27.0 41.0 50 35.9505 39.0 35.0 41.0 27.0 41.0 51 35.81525 39.0 35.0 41.0 26.0 41.0 52 33.72525 38.0 31.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1301 1 0.0 1301 2 0.0 1301 3 0.0 1301 4 0.0 1301 5 0.0 1301 6 0.0 1301 7 0.0 1301 8 0.0 1301 9 0.0 1301 10 0.0 1301 11 0.0 1301 12 0.0 1301 13 0.0 1301 14 0.0 1301 15 0.0 1301 16 0.0 1301 17 0.0 1301 18 0.0 1301 19 0.0 1301 20 0.0 1301 21 0.0 1301 22 0.0 1301 23 0.0 1301 24 0.0 1301 25 0.0 1301 26 0.0 1301 27 0.0 1301 28 0.0 1301 29 0.0 1301 30 0.0 1301 31 0.0 1301 32 0.0 1301 33 0.0 1301 34 0.0 1301 35 0.0 1301 36 0.0 1301 37 0.0 1301 38 0.0 1301 39 0.0 1301 40 0.0 1301 41 0.0 1301 42 0.0 1301 43 0.0 1301 44 0.0 1301 45 0.0 1301 46 0.0 1301 47 0.0 1301 48 0.0 1301 49 0.0 1301 50 0.0 1301 51 0.0 1301 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 3.0 20 1.0 21 1.0 22 9.0 23 12.0 24 14.0 25 23.0 26 28.0 27 41.0 28 43.0 29 54.0 30 69.0 31 82.0 32 96.0 33 125.0 34 159.0 35 187.0 36 273.0 37 402.0 38 664.0 39 1708.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 9.775 5.625 45.550000000000004 2 23.075000000000003 15.299999999999999 35.025 26.6 3 22.625 15.8 23.65 37.925 4 24.875 25.825 21.775 27.525 5 25.2 30.225 24.075 20.5 6 16.625 32.775 26.224999999999998 24.375 7 15.275 21.725 43.075 19.925 8 17.424999999999997 22.6 30.85 29.125 9 18.95 20.424999999999997 34.4 26.224999999999998 10 18.35 36.85 24.4 20.4 11 22.825 26.424999999999997 23.45 27.3 12 22.325 23.474999999999998 26.875 27.325 13 19.950000000000003 26.900000000000002 28.225 24.925 14 20.65 26.150000000000002 28.999999999999996 24.2 15 20.65 25.2 27.6 26.55 16 21.175 26.275 26.3 26.25 17 22.25 25.124999999999996 26.625 26.0 18 20.925 25.5 28.299999999999997 25.275 19 20.150000000000002 26.700000000000003 26.05 27.1 20 21.05 24.775 28.499999999999996 25.674999999999997 21 21.825 25.5 26.55 26.125 22 21.625 26.35 25.874999999999996 26.150000000000002 23 22.075 26.650000000000002 26.174999999999997 25.1 24 20.95 26.375 26.474999999999998 26.200000000000003 25 22.475 25.6 26.35 25.575 26 21.2 25.025 27.075 26.700000000000003 27 21.85 25.674999999999997 25.8 26.674999999999997 28 20.8 26.700000000000003 27.700000000000003 24.8 29 22.575 26.224999999999998 28.199999999999996 23.0 30 22.875 24.65 25.724999999999998 26.75 31 21.7 26.325 26.674999999999997 25.3 32 22.375 27.05 25.650000000000002 24.925 33 22.5 24.975 25.5 27.025 34 20.95 26.55 26.85 25.650000000000002 35 22.3 25.2 26.174999999999997 26.325 36 21.125 24.9 25.825 28.15 37 22.075 24.175 25.874999999999996 27.875 38 22.15 25.1 26.075 26.674999999999997 39 21.775 25.724999999999998 25.374999999999996 27.125 40 21.25 25.224999999999998 27.85 25.674999999999997 41 22.325 25.224999999999998 25.575 26.875 42 22.525000000000002 24.725 25.900000000000002 26.85 43 22.525000000000002 25.324999999999996 25.974999999999998 26.174999999999997 44 22.8 25.275 24.975 26.950000000000003 45 23.0 23.025000000000002 26.174999999999997 27.800000000000004 46 22.075 25.575 25.85 26.5 47 24.012006003001503 24.512256128064035 25.887943971985994 25.587793896948476 48 21.975 25.025 26.85 26.150000000000002 49 22.875 24.65 25.124999999999996 27.35 50 22.225 25.424999999999997 25.4 26.950000000000003 51 22.15 24.725 25.8 27.325 52 22.825 25.35 24.325 27.500000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 1.0 8 2.0 9 1.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 3.0 22 6.0 23 9.0 24 14.0 25 19.0 26 21.5 27 24.0 28 31.5 29 39.0 30 46.0 31 53.0 32 72.5 33 92.0 34 106.5 35 121.0 36 129.0 37 137.0 38 151.5 39 192.0 40 218.0 41 223.5 42 229.0 43 257.5 44 286.0 45 310.5 46 335.0 47 319.0 48 303.0 49 323.5 50 344.0 51 342.5 52 341.0 53 328.0 54 315.0 55 280.5 56 246.0 57 220.5 58 195.0 59 168.0 60 141.0 61 130.5 62 120.0 63 94.5 64 63.5 65 58.0 66 57.5 67 57.0 68 40.0 69 23.0 70 21.0 71 19.0 72 11.5 73 4.0 74 4.5 75 5.0 76 7.0 77 9.0 78 7.5 79 6.0 80 4.5 81 3.0 82 2.5 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.05 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.31000261164795 93.15 2 1.67145468790807 3.2 3 0.6529119874640898 1.875 4 0.15669887699138157 0.6 5 0.10446591799425438 0.5 6 0.026116479498563595 0.15 7 0.07834943849569079 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 7 0.17500000000000002 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 7 0.17500000000000002 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 7 0.17500000000000002 No Hit CTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGCA 6 0.15 No Hit CTCCTATTTACTGCGGCGACGAAGAATCAAATTATCACTATATTTATTCCTT 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit GTGAGGTTCATATTAGGGAAAGGAGAGCACGGGGAAGAGGGGGCTCGGCCCG 5 0.125 No Hit GCCCTTCTCCGACCCTTACTGCCCAACCTGAGAGCGGACAGCTAATGCGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra Read 200000 spots for SRR5423323.sra Written 200000 spots for SRR5423323.sra SRR ids: ['SRR5423323.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6g4tymvg SRR5423323.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423323 file size 703974 SRR5423323 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423323 SRR5423323_1.fastq Input file: SRR5423323_1.fastq trimmed: SRR5423323-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:27:00 2025 >> started Wed Feb 12 07:27:02 2025 >> done (1.835s) 4000000 reads processed; of these: 106 ( 0.00%) short reads filtered out after trimming by size control 75 ( 0.00%) empty reads filtered out after trimming by size control 3999819 (100.00%) reads available; of these: 121415 ( 3.04%) trimmed reads available after processing 3878404 (96.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 8 0.00% 25 14 0.00% 26 14 0.00% 27 19 0.00% 28 15 0.00% 29 26 0.00% 30 20 0.00% 31 24 0.00% 32 47 0.00% 33 60 0.00% 34 55 0.00% 35 71 0.00% 36 78 0.00% 37 102 0.00% 38 130 0.00% 39 167 0.00% 40 227 0.01% 41 272 0.01% 42 341 0.01% 43 391 0.01% 44 736 0.02% 45 952 0.02% 46 1204 0.03% 47 1702 0.04% 48 2775 0.07% 49 6353 0.16% 50 15990 0.40% 51 89597 2.24% 52 3878404 96.96% 3999819 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=24.17 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 07:27:15 Started mapping on | Feb 12 07:27:15 Finished on | Feb 12 07:27:20 Mapping speed, Million of reads per hour | 2879.87 Number of input reads | 3999819 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305108 Uniquely mapped reads % | 82.63% Average mapped length | 51.76 Number of splices: Total | 318632 Number of splices: Annotated (sjdb) | 314097 Number of splices: GT/AG | 311379 Number of splices: GC/AG | 5678 Number of splices: AT/AC | 530 Number of splices: Non-canonical | 1045 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464252 % of reads mapped to multiple loci | 11.61% Number of reads mapped to too many loci | 121867 % of reads mapped to too many loci | 3.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230459 230459 230459 N_multimapping 464252 464252 464252 N_noFeature 616518 3234154 675509 N_ambiguous 25194 171 13070 UnstrandedReadsAssigned:2663396 PositiveStrandReadsAssigned:70783 NegativeStrandReadsAssigned:2616529 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423323 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423323-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,819 reads, 2,972,637 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR5423323.ke.tsv 34699 SRR5423323.se.tsv 87100 total ==> SRR5423323.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 94 16.9487 Potri.005G024800.1.v4.1 1035 936 2 0.739329 Potri.004G059700.1.v4.1 961 862 5 2.007 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 73.4335 8.93405 Potri.016G087400.1.v4.1 270 171 31 62.7263 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 43 16.9456 ==> SRR5423323.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 42 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423323 completed mapping pipeline successfully