Starting /dee2/code/volunteer_pipeline.sh SRR5423324 current disk space = 3050000838656 free memory = 1293313600 SRR5423324 SRAfilesize da4faac03afe5ebb17b6e2fb1cdc360b SRR5423324.sra SRR5423324.sra file validated SRR5423324 is single end SRR5423324 is conventional basespace SRR5423324 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423324_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.04275 33.0 31.0 34.0 30.0 34.0 2 32.03625 34.0 31.0 34.0 30.0 34.0 3 32.16975 34.0 31.0 34.0 30.0 34.0 4 35.41025 37.0 35.0 37.0 32.0 37.0 5 35.3815 37.0 35.0 37.0 33.0 37.0 6 35.46325 37.0 35.0 37.0 33.0 37.0 7 35.63025 37.0 35.0 37.0 33.0 37.0 8 35.645 37.0 35.0 37.0 33.0 37.0 9 37.3255 39.0 37.0 39.0 34.0 39.0 10 37.1545 39.0 37.0 39.0 33.0 39.0 11 37.24875 39.0 37.0 39.0 33.0 39.0 12 37.36575 39.0 37.0 39.0 34.0 39.0 13 37.2465 39.0 37.0 39.0 33.0 39.0 14 38.23575 40.0 38.0 41.0 33.0 41.0 15 38.54825 40.0 38.0 41.0 34.0 41.0 16 38.35775 40.0 38.0 41.0 33.0 41.0 17 38.3515 40.0 38.0 41.0 33.0 41.0 18 38.39525 40.0 38.0 41.0 34.0 41.0 19 38.63675 40.0 38.0 41.0 34.0 41.0 20 38.625 40.0 38.0 41.0 34.0 41.0 21 38.4685 40.0 38.0 41.0 34.0 41.0 22 38.225 40.0 38.0 41.0 33.0 41.0 23 38.30975 40.0 38.0 41.0 33.0 41.0 24 38.40175 40.0 38.0 41.0 34.0 41.0 25 38.21375 40.0 38.0 41.0 33.0 41.0 26 38.3715 40.0 38.0 41.0 34.0 41.0 27 38.2675 40.0 38.0 41.0 33.0 41.0 28 38.10825 40.0 38.0 41.0 33.0 41.0 29 37.70725 40.0 37.0 41.0 32.0 41.0 30 38.01925 40.0 37.0 41.0 33.0 41.0 31 38.13675 40.0 37.0 41.0 33.0 41.0 32 37.7605 40.0 37.0 41.0 32.0 41.0 33 37.8595 40.0 37.0 41.0 33.0 41.0 34 37.63375 40.0 37.0 41.0 32.0 41.0 35 37.7095 40.0 37.0 41.0 32.0 41.0 36 37.62275 40.0 37.0 41.0 32.0 41.0 37 37.4215 40.0 37.0 41.0 31.0 41.0 38 37.5745 40.0 37.0 41.0 32.0 41.0 39 37.6865 40.0 37.0 41.0 32.0 41.0 40 37.5755 40.0 37.0 41.0 32.0 41.0 41 37.48475 40.0 37.0 41.0 32.0 41.0 42 37.43475 40.0 37.0 41.0 31.0 41.0 43 37.469 40.0 37.0 41.0 32.0 41.0 44 36.891 39.0 35.0 41.0 30.0 41.0 45 36.945 39.0 35.0 41.0 30.0 41.0 46 36.675 39.0 35.0 41.0 30.0 41.0 47 36.884 39.0 35.0 41.0 31.0 41.0 48 36.92975 39.0 35.0 41.0 30.0 41.0 49 36.891 39.0 35.0 41.0 30.0 41.0 50 36.6515 39.0 35.0 41.0 30.0 41.0 51 36.69 39.0 35.0 41.0 30.0 41.0 52 35.32125 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1309 1 0.0 1309 2 0.0 1309 3 0.0 1309 4 0.0 1309 5 0.0 1309 6 0.0 1309 7 0.0 1309 8 0.0 1309 9 0.0 1309 10 0.0 1309 11 0.0 1309 12 0.0 1309 13 0.0 1309 14 0.0 1309 15 0.0 1309 16 0.0 1309 17 0.0 1309 18 0.0 1309 19 0.0 1309 20 0.0 1309 21 0.0 1309 22 0.0 1309 23 0.0 1309 24 0.0 1309 25 0.0 1309 26 0.0 1309 27 0.0 1309 28 0.0 1309 29 0.0 1309 30 0.0 1309 31 0.0 1309 32 0.0 1309 33 0.0 1309 34 0.0 1309 35 0.0 1309 36 0.0 1309 37 0.0 1309 38 0.0 1309 39 0.0 1309 40 0.0 1309 41 0.0 1309 42 0.0 1309 43 0.0 1309 44 0.0 1309 45 0.0 1309 46 0.0 1309 47 0.0 1309 48 0.0 1309 49 0.0 1309 50 0.0 1309 51 0.0 1309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 3.0 24 8.0 25 13.0 26 13.0 27 29.0 28 38.0 29 53.0 30 74.0 31 79.0 32 121.0 33 158.0 34 187.0 35 245.0 36 352.0 37 454.0 38 705.0 39 1460.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65991497874469 10.827706926731683 5.376344086021505 44.13603400850212 2 24.05 13.475000000000001 35.775 26.700000000000003 3 22.775000000000002 17.25 24.3 35.675000000000004 4 24.425 24.9 21.85 28.825 5 24.95 30.975 23.825 20.25 6 19.375 32.475 24.025 24.125 7 15.5 22.15 43.175000000000004 19.175 8 18.15 21.525 31.4 28.925 9 18.425 21.15 33.650000000000006 26.775 10 18.675 35.55 25.35 20.424999999999997 11 23.625 26.6 22.075 27.700000000000003 12 22.975 22.15 26.875 28.000000000000004 13 19.15 26.6 28.875 25.374999999999996 14 20.5 26.825 27.575 25.1 15 21.925 25.95 26.974999999999998 25.15 16 20.974999999999998 26.525 26.424999999999997 26.075 17 22.075 25.275 26.650000000000002 26.0 18 21.675 26.1 26.924999999999997 25.3 19 21.15 26.35 25.55 26.950000000000003 20 22.375 25.4 25.45 26.775 21 21.675 26.525 25.1 26.700000000000003 22 22.175 26.400000000000002 26.325 25.1 23 23.400000000000002 25.45 25.55 25.6 24 22.125 25.424999999999997 25.324999999999996 27.125 25 21.5 27.474999999999998 25.4 25.624999999999996 26 22.15 26.075 26.5 25.275 27 23.275000000000002 24.25 26.875 25.6 28 22.125 26.25 25.474999999999998 26.150000000000002 29 20.375 27.375 27.425 24.825 30 21.575 25.55 25.15 27.725 31 22.400000000000002 26.400000000000002 26.700000000000003 24.5 32 20.525 26.474999999999998 26.950000000000003 26.05 33 21.575 25.775 25.374999999999996 27.275 34 21.3 25.775 27.650000000000002 25.275 35 22.45 24.6 26.224999999999998 26.724999999999998 36 21.0 26.125 24.45 28.425 37 21.325 26.125 26.375 26.174999999999997 38 21.45 25.775 26.200000000000003 26.575 39 21.9 25.424999999999997 25.2 27.474999999999998 40 20.875 25.2 27.625 26.3 41 23.150000000000002 26.474999999999998 25.674999999999997 24.7 42 22.275 24.95 26.575 26.200000000000003 43 22.475 25.775 26.025 25.724999999999998 44 23.325000000000003 25.025 26.075 25.575 45 22.400000000000002 24.65 25.0 27.950000000000003 46 22.650000000000002 24.875 26.1 26.375 47 23.3 26.375 23.625 26.700000000000003 48 22.25 25.874999999999996 26.25 25.624999999999996 49 23.05 24.85 25.224999999999998 26.875 50 22.25 25.75 27.025 24.975 51 22.8 25.1 25.974999999999998 26.125 52 22.625 26.200000000000003 25.074999999999996 26.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 2.0 19 2.0 20 2.0 21 2.0 22 7.5 23 13.0 24 14.0 25 15.0 26 22.5 27 30.0 28 27.5 29 25.0 30 35.5 31 46.0 32 61.0 33 76.0 34 84.5 35 93.0 36 126.0 37 159.0 38 172.0 39 208.0 40 231.0 41 247.5 42 264.0 43 279.5 44 295.0 45 304.5 46 314.0 47 294.5 48 275.0 49 315.0 50 355.0 51 347.5 52 340.0 53 320.5 54 301.0 55 273.0 56 245.0 57 219.5 58 194.0 59 171.0 60 148.0 61 140.0 62 132.0 63 100.5 64 66.0 65 63.0 66 54.0 67 45.0 68 35.0 69 25.0 70 22.5 71 20.0 72 19.0 73 18.0 74 11.5 75 5.0 76 4.5 77 4.0 78 3.0 79 2.0 80 2.5 81 3.0 82 1.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.95538057742782 92.35 2 2.073490813648294 3.95 3 0.4461942257217848 1.275 4 0.2887139107611548 1.0999999999999999 5 0.13123359580052493 0.625 6 0.026246719160104987 0.15 7 0.05249343832020997 0.35000000000000003 8 0.026246719160104987 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 8 0.2 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 7 0.17500000000000002 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 7 0.17500000000000002 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 5 0.125 No Hit GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra Read 200000 spots for SRR5423324.sra Written 200000 spots for SRR5423324.sra SRR ids: ['SRR5423324.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_49wypq46 SRR5423324.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423324 file size 703911 SRR5423324 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423324 SRR5423324_1.fastq Input file: SRR5423324_1.fastq trimmed: SRR5423324-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:11:15 2025 >> started Wed Feb 12 07:11:17 2025 >> done (1.720s) 4000000 reads processed; of these: 141 ( 0.00%) short reads filtered out after trimming by size control 67 ( 0.00%) empty reads filtered out after trimming by size control 3999792 (99.99%) reads available; of these: 81297 ( 2.03%) trimmed reads available after processing 3918495 (97.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 6 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 3 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 6 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 19 0.00% 34 19 0.00% 35 14 0.00% 36 31 0.00% 37 29 0.00% 38 34 0.00% 39 38 0.00% 40 58 0.00% 41 64 0.00% 42 108 0.00% 43 102 0.00% 44 181 0.00% 45 282 0.01% 46 411 0.01% 47 664 0.02% 48 1182 0.03% 49 3191 0.08% 50 9496 0.24% 51 65319 1.63% 52 3918495 97.97% 3999792 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=24.38 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTTCG Started job on | Feb 12 07:11:28 Started mapping on | Feb 12 07:11:29 Finished on | Feb 12 07:11:34 Mapping speed, Million of reads per hour | 2879.85 Number of input reads | 3999792 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3302146 Uniquely mapped reads % | 82.56% Average mapped length | 51.78 Number of splices: Total | 318207 Number of splices: Annotated (sjdb) | 313878 Number of splices: GT/AG | 310879 Number of splices: GC/AG | 5760 Number of splices: AT/AC | 521 Number of splices: Non-canonical | 1047 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462039 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 130614 % of reads mapped to too many loci | 3.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235607 235607 235607 N_multimapping 462039 462039 462039 N_noFeature 620092 3232128 678329 N_ambiguous 24984 204 13016 UnstrandedReadsAssigned:2657070 PositiveStrandReadsAssigned:69814 NegativeStrandReadsAssigned:2610801 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423324 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423324-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,792 reads, 2,961,995 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR5423324.ke.tsv 34699 SRR5423324.se.tsv 87100 total ==> SRR5423324.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 86 15.5958 Potri.005G024800.1.v4.1 1035 936 1 0.371799 Potri.004G059700.1.v4.1 961 862 4 1.61487 Potri.007G009000.2.v4.1 1416 1317 1 0.26424 Potri.003G141000.2.v4.1 2943 2844 58.6195 7.17293 Potri.016G087400.1.v4.1 270 171 29 59.0182 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.207888 Potri.012G127500.1.v4.1 977 878 25 9.909 ==> SRR5423324.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 44 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423324 completed mapping pipeline successfully