Starting /dee2/code/volunteer_pipeline.sh SRR5423325 current disk space = 3049838587904 free memory = 1575836872 SRR5423325 SRAfilesize ad90dc2767b119a80407a88cb120614f SRR5423325.sra SRR5423325.sra file validated SRR5423325 is single end SRR5423325 is conventional basespace SRR5423325 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34725 34.0 31.0 34.0 30.0 34.0 2 32.49325 34.0 31.0 34.0 31.0 34.0 3 32.5935 34.0 31.0 34.0 30.0 34.0 4 36.0835 37.0 35.0 37.0 35.0 37.0 5 36.03 37.0 35.0 37.0 35.0 37.0 6 36.068 37.0 35.0 37.0 35.0 37.0 7 36.03375 37.0 35.0 37.0 35.0 37.0 8 35.9765 37.0 35.0 37.0 35.0 37.0 9 37.74375 39.0 38.0 39.0 35.0 39.0 10 37.548 39.0 37.0 39.0 35.0 39.0 11 37.53075 39.0 37.0 39.0 35.0 39.0 12 37.6355 39.0 37.0 39.0 35.0 39.0 13 37.57475 39.0 37.0 39.0 35.0 39.0 14 38.98025 40.0 38.0 41.0 36.0 41.0 15 38.9925 40.0 38.0 41.0 36.0 41.0 16 38.806 40.0 38.0 41.0 35.0 41.0 17 38.9775 40.0 38.0 41.0 36.0 41.0 18 38.94175 40.0 38.0 41.0 35.0 41.0 19 38.85175 40.0 38.0 41.0 35.0 41.0 20 38.7965 40.0 38.0 41.0 34.0 41.0 21 38.72925 40.0 38.0 41.0 35.0 41.0 22 38.617 40.0 38.0 41.0 34.0 41.0 23 38.27275 40.0 38.0 41.0 33.0 41.0 24 38.434 40.0 38.0 41.0 34.0 41.0 25 38.49525 40.0 38.0 41.0 34.0 41.0 26 38.249 40.0 38.0 41.0 33.0 41.0 27 38.148 40.0 38.0 41.0 34.0 41.0 28 37.944 40.0 38.0 41.0 33.0 41.0 29 38.1245 40.0 38.0 41.0 33.0 41.0 30 37.99425 40.0 38.0 41.0 33.0 41.0 31 37.89175 40.0 38.0 41.0 33.0 41.0 32 37.60025 40.0 38.0 41.0 32.0 41.0 33 37.3885 40.0 37.0 41.0 31.0 41.0 34 37.5795 40.0 37.0 41.0 31.0 41.0 35 37.4755 40.0 37.0 41.0 31.0 41.0 36 37.33075 40.0 37.0 41.0 31.0 41.0 37 37.1225 40.0 37.0 41.0 30.0 41.0 38 37.2085 40.0 37.0 41.0 31.0 41.0 39 37.214 40.0 37.0 41.0 31.0 41.0 40 37.03275 40.0 37.0 41.0 30.0 41.0 41 37.01875 40.0 37.0 41.0 30.0 41.0 42 36.93925 40.0 36.0 41.0 30.0 41.0 43 36.75175 40.0 36.0 41.0 30.0 41.0 44 36.58825 40.0 36.0 41.0 29.0 41.0 45 36.60675 39.0 36.0 41.0 30.0 41.0 46 36.55075 39.0 36.0 41.0 29.0 41.0 47 36.1305 39.0 35.0 41.0 28.0 41.0 48 35.93975 39.0 35.0 41.0 27.0 41.0 49 35.8555 39.0 35.0 40.0 26.0 41.0 50 35.7745 39.0 35.0 41.0 26.0 41.0 51 35.70175 39.0 35.0 41.0 26.0 41.0 52 33.54025 37.0 31.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10 0.0 2101 11 0.0 2101 12 0.0 2101 13 0.0 2101 14 0.0 2101 15 0.0 2101 16 0.0 2101 17 0.0 2101 18 0.0 2101 19 0.0 2101 20 0.0 2101 21 0.0 2101 22 0.0 2101 23 0.0 2101 24 0.0 2101 25 0.0 2101 26 0.0 2101 27 0.0 2101 28 0.0 2101 29 0.0 2101 30 0.0 2101 31 0.0 2101 32 0.0 2101 33 0.0 2101 34 0.0 2101 35 0.0 2101 36 0.0 2101 37 0.0 2101 38 0.0 2101 39 0.0 2101 40 0.0 2101 41 0.0 2101 42 0.0 2101 43 0.0 2101 44 0.0 2101 45 0.0 2101 46 0.0 2101 47 0.0 2101 48 0.0 2101 49 0.0 2101 50 0.0 2101 51 0.0 2101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 6.0 21 5.0 22 8.0 23 10.0 24 12.0 25 30.0 26 26.0 27 34.0 28 52.0 29 51.0 30 60.0 31 87.0 32 97.0 33 128.0 34 161.0 35 214.0 36 259.0 37 412.0 38 763.0 39 1581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.97341359418109 11.562578379734136 6.069726611487334 44.394281414597444 2 23.599999999999998 13.950000000000001 36.1 26.35 3 21.375 18.275 24.224999999999998 36.125 4 25.474999999999998 26.200000000000003 20.849999999999998 27.474999999999998 5 24.325 31.474999999999998 23.1 21.099999999999998 6 19.8 32.225 25.224999999999998 22.75 7 15.425 24.075 41.775 18.725 8 17.0 22.25 30.75 30.0 9 18.8 22.225 33.575 25.4 10 19.05 37.95 23.75 19.25 11 24.075 26.275 21.625 28.025 12 21.5 24.15 25.25 29.099999999999998 13 20.0 26.974999999999998 27.85 25.174999999999997 14 19.45 27.474999999999998 28.625 24.45 15 21.6 25.674999999999997 26.85 25.874999999999996 16 21.55 26.174999999999997 25.900000000000002 26.375 17 21.4 25.5 26.674999999999997 26.424999999999997 18 21.8 26.325 26.5 25.374999999999996 19 21.175 27.275 26.674999999999997 24.875 20 22.1 26.224999999999998 26.400000000000002 25.275 21 22.125 26.025 25.074999999999996 26.775 22 21.825 26.75 25.525 25.900000000000002 23 23.724999999999998 26.575 24.975 24.725 24 24.175 24.3 25.724999999999998 25.8 25 22.2 25.75 25.124999999999996 26.924999999999997 26 22.825 25.15 26.8 25.224999999999998 27 21.45 24.575 26.35 27.625 28 21.725 27.075 26.85 24.349999999999998 29 21.75 25.4 28.425 24.425 30 21.075 25.05 27.6 26.275 31 23.474999999999998 25.124999999999996 25.8 25.6 32 22.225 26.3 25.874999999999996 25.6 33 22.2 25.25 26.05 26.5 34 21.975 26.25 26.125 25.650000000000002 35 21.425 25.874999999999996 27.0 25.7 36 23.3 24.349999999999998 25.474999999999998 26.875 37 20.424999999999997 25.900000000000002 25.724999999999998 27.950000000000003 38 22.400000000000002 26.200000000000003 25.674999999999997 25.724999999999998 39 22.125 23.925 26.275 27.675 40 21.475 26.724999999999998 26.575 25.224999999999998 41 22.8 24.675 24.95 27.575 42 22.15 24.0 26.3 27.55 43 22.85 25.424999999999997 25.35 26.375 44 22.6 25.324999999999996 26.075 26.0 45 22.625 24.575 25.924999999999997 26.875 46 22.575 25.775 25.650000000000002 26.0 47 23.925 24.175 26.125 25.775 48 21.775 25.55 25.1 27.575 49 22.45 26.650000000000002 25.0 25.900000000000002 50 22.25 25.374999999999996 25.0 27.375 51 22.475 25.1 25.2 27.224999999999998 52 22.175 25.6 24.9 27.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 1.0 18 2.5 19 4.0 20 4.0 21 4.0 22 6.0 23 8.0 24 13.5 25 19.0 26 19.5 27 20.0 28 29.0 29 38.0 30 42.0 31 46.0 32 59.0 33 72.0 34 90.0 35 108.0 36 124.0 37 140.0 38 153.5 39 201.0 40 235.0 41 245.0 42 255.0 43 274.5 44 294.0 45 306.0 46 318.0 47 319.5 48 321.0 49 330.5 50 340.0 51 317.5 52 295.0 53 298.5 54 302.0 55 281.0 56 260.0 57 239.0 58 218.0 59 188.5 60 159.0 61 143.5 62 128.0 63 102.5 64 68.5 65 60.0 66 45.5 67 31.0 68 25.5 69 20.0 70 19.5 71 19.0 72 17.5 73 16.0 74 11.0 75 6.0 76 5.5 77 5.0 78 4.0 79 3.0 80 3.5 81 4.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.10107077565944 92.95 2 2.063201880386524 3.95 3 0.4178636719770175 1.2 4 0.2872812744841995 1.0999999999999999 5 0.05223295899712719 0.25 6 0.05223295899712719 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026116479498563595 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 10 0.25 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 6 0.15 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 6 0.15 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra Read 200000 spots for SRR5423325.sra Written 200000 spots for SRR5423325.sra SRR ids: ['SRR5423325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibv2eep3 SRR5423325.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423325 file size 703969 SRR5423325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423325 SRR5423325_1.fastq Input file: SRR5423325_1.fastq trimmed: SRR5423325-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:35:10 2025 >> started Wed Feb 12 07:35:12 2025 >> done (1.963s) 4000000 reads processed; of these: 125 ( 0.00%) short reads filtered out after trimming by size control 61 ( 0.00%) empty reads filtered out after trimming by size control 3999814 (100.00%) reads available; of these: 137148 ( 3.43%) trimmed reads available after processing 3862666 (96.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 6 0.00% 24 2 0.00% 25 13 0.00% 26 6 0.00% 27 16 0.00% 28 18 0.00% 29 17 0.00% 30 22 0.00% 31 25 0.00% 32 38 0.00% 33 55 0.00% 34 65 0.00% 35 56 0.00% 36 98 0.00% 37 110 0.00% 38 129 0.00% 39 180 0.00% 40 226 0.01% 41 306 0.01% 42 389 0.01% 43 556 0.01% 44 799 0.02% 45 1192 0.03% 46 1393 0.03% 47 2098 0.05% 48 3456 0.09% 49 6871 0.17% 50 17685 0.44% 51 101310 2.53% 52 3862666 96.57% 3999814 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.05 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:35:26 Started mapping on | Feb 12 07:35:26 Finished on | Feb 12 07:35:34 Mapping speed, Million of reads per hour | 1799.92 Number of input reads | 3999814 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305236 Uniquely mapped reads % | 82.63% Average mapped length | 51.74 Number of splices: Total | 317047 Number of splices: Annotated (sjdb) | 312572 Number of splices: GT/AG | 309660 Number of splices: GC/AG | 5864 Number of splices: AT/AC | 448 Number of splices: Non-canonical | 1075 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464706 % of reads mapped to multiple loci | 11.62% Number of reads mapped to too many loci | 119535 % of reads mapped to too many loci | 2.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 229872 229872 229872 N_multimapping 464706 464706 464706 N_noFeature 614104 3234567 672886 N_ambiguous 25033 197 12967 UnstrandedReadsAssigned:2666099 PositiveStrandReadsAssigned:70472 NegativeStrandReadsAssigned:2619383 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423325 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423325-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,814 reads, 2,963,172 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR5423325.ke.tsv 34699 SRR5423325.se.tsv 87100 total ==> SRR5423325.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 97 17.537 Potri.005G024800.1.v4.1 1035 936 2 0.741332 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 65.3925 7.97731 Potri.016G087400.1.v4.1 270 171 21 42.6071 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.207254 Potri.012G127500.1.v4.1 977 878 23 9.08849 ==> SRR5423325.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 40 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423325 completed mapping pipeline successfully