Starting /dee2/code/volunteer_pipeline.sh SRR5423326 current disk space = 3049752821760 free memory = 1582308936 SRR5423326 SRAfilesize 8758a4cd78230bb0ca536ec9201a5fa3 SRR5423326.sra SRR5423326.sra file validated SRR5423326 is single end SRR5423326 is conventional basespace SRR5423326 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92825 31.0 31.0 34.0 30.0 34.0 2 32.01775 33.0 31.0 34.0 30.0 34.0 3 32.00525 34.0 31.0 34.0 30.0 34.0 4 35.433 37.0 35.0 37.0 33.0 37.0 5 35.417 37.0 35.0 37.0 33.0 37.0 6 35.47625 37.0 35.0 37.0 33.0 37.0 7 35.522 37.0 35.0 37.0 33.0 37.0 8 35.602 37.0 35.0 37.0 33.0 37.0 9 37.28625 39.0 37.0 39.0 34.0 39.0 10 36.982 39.0 37.0 39.0 33.0 39.0 11 37.1405 39.0 37.0 39.0 33.0 39.0 12 37.2515 39.0 37.0 39.0 34.0 39.0 13 37.04225 39.0 37.0 39.0 33.0 39.0 14 38.377 40.0 38.0 41.0 33.0 41.0 15 38.2205 40.0 38.0 41.0 33.0 41.0 16 38.328 40.0 38.0 41.0 33.0 41.0 17 38.2245 40.0 38.0 41.0 33.0 41.0 18 38.05375 40.0 37.0 41.0 33.0 41.0 19 38.1425 40.0 37.0 41.0 33.0 41.0 20 38.2045 40.0 38.0 41.0 34.0 41.0 21 38.147 40.0 37.0 41.0 33.0 41.0 22 38.1375 40.0 37.0 41.0 33.0 41.0 23 38.12175 40.0 38.0 41.0 33.0 41.0 24 38.19 40.0 38.0 41.0 33.0 41.0 25 38.1615 40.0 37.0 41.0 33.0 41.0 26 37.90875 40.0 37.0 41.0 33.0 41.0 27 37.80825 40.0 37.0 41.0 32.0 41.0 28 37.7915 40.0 37.0 41.0 32.0 41.0 29 37.7485 40.0 37.0 41.0 32.0 41.0 30 37.5915 40.0 37.0 41.0 32.0 41.0 31 37.28425 40.0 36.0 41.0 31.0 41.0 32 37.61675 40.0 37.0 41.0 32.0 41.0 33 37.484 40.0 37.0 41.0 32.0 41.0 34 37.549 40.0 37.0 41.0 31.0 41.0 35 37.29075 40.0 37.0 41.0 31.0 41.0 36 36.949 39.0 36.0 41.0 30.0 41.0 37 37.118 39.0 36.0 41.0 30.0 41.0 38 37.10475 39.0 36.0 41.0 31.0 41.0 39 37.24025 40.0 36.0 41.0 31.0 41.0 40 37.153 40.0 36.0 41.0 31.0 41.0 41 36.9765 39.0 36.0 41.0 31.0 41.0 42 37.069 39.0 36.0 41.0 31.0 41.0 43 36.9555 39.0 36.0 41.0 30.0 41.0 44 36.8245 39.0 35.0 41.0 30.0 41.0 45 36.55125 39.0 35.0 41.0 29.0 41.0 46 36.44675 39.0 35.0 40.0 29.0 41.0 47 36.383 39.0 35.0 40.0 29.0 41.0 48 36.4615 39.0 35.0 40.0 30.0 41.0 49 36.36325 39.0 35.0 40.0 29.0 41.0 50 36.3685 39.0 35.0 40.0 29.0 41.0 51 36.32075 39.0 35.0 40.0 29.0 41.0 52 34.919 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2109 1 0.0 2109 2 0.0 2109 3 0.0 2109 4 0.0 2109 5 0.0 2109 6 0.0 2109 7 0.0 2109 8 0.0 2109 9 0.0 2109 10 0.0 2109 11 0.0 2109 12 0.0 2109 13 0.0 2109 14 0.0 2109 15 0.0 2109 16 0.0 2109 17 0.0 2109 18 0.0 2109 19 0.0 2109 20 0.0 2109 21 0.0 2109 22 0.0 2109 23 0.0 2109 24 0.0 2109 25 0.0 2109 26 0.0 2109 27 0.0 2109 28 0.0 2109 29 0.0 2109 30 0.0 2109 31 0.0 2109 32 0.0 2109 33 0.0 2109 34 0.0 2109 35 0.0 2109 36 0.0 2109 37 0.0 2109 38 0.0 2109 39 0.0 2109 40 0.0 2109 41 0.0 2109 42 0.0 2109 43 0.0 2109 44 0.0 2109 45 0.0 2109 46 0.0 2109 47 0.0 2109 48 0.0 2109 49 0.0 2109 50 0.0 2109 51 0.0 2109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 3.0 22 4.0 23 11.0 24 16.0 25 13.0 26 23.0 27 32.0 28 43.0 29 58.0 30 90.0 31 88.0 32 121.0 33 176.0 34 197.0 35 250.0 36 349.0 37 458.0 38 761.0 39 1301.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.774718397997496 11.439299123904881 6.107634543178974 42.67834793491865 2 25.05 13.625000000000002 34.949999999999996 26.375 3 22.3 17.424999999999997 24.275 36.0 4 25.45 25.4 21.099999999999998 28.050000000000004 5 24.325 31.574999999999996 23.45 20.65 6 19.725 33.875 24.375 22.025 7 14.299999999999999 23.150000000000002 42.925000000000004 19.625 8 18.925 21.325 31.275 28.475 9 17.224999999999998 20.45 34.675 27.650000000000002 10 18.025 35.975 25.674999999999997 20.325 11 23.925 26.924999999999997 22.3 26.85 12 22.85 22.925 27.400000000000002 26.825 13 19.875 26.125 29.075 24.925 14 20.575 28.449999999999996 26.974999999999998 24.0 15 21.0 26.674999999999997 27.325 25.0 16 21.9 25.0 27.400000000000002 25.7 17 21.65 25.650000000000002 27.6 25.1 18 23.075000000000003 26.325 25.1 25.5 19 22.8 26.625 25.25 25.324999999999996 20 21.675 27.150000000000002 27.025 24.15 21 21.7 26.700000000000003 27.325 24.275 22 21.075 27.975 25.45 25.5 23 22.875 25.95 25.124999999999996 26.05 24 21.975 24.85 26.5 26.674999999999997 25 21.325 26.900000000000002 25.974999999999998 25.8 26 23.400000000000002 25.724999999999998 25.95 24.925 27 22.725 25.825 25.75 25.7 28 22.35 25.3 26.6 25.75 29 22.2 25.5 26.0 26.3 30 21.6 24.05 27.05 27.3 31 21.775 26.424999999999997 25.3 26.5 32 22.975 26.025 25.324999999999996 25.674999999999997 33 22.775000000000002 25.55 26.85 24.825 34 22.3 25.8 26.525 25.374999999999996 35 22.0 26.400000000000002 25.624999999999996 25.974999999999998 36 21.95 26.325 25.4 26.325 37 21.425 24.8 26.474999999999998 27.3 38 21.675 24.775 26.974999999999998 26.575 39 20.525 24.75 26.474999999999998 28.249999999999996 40 20.674999999999997 26.25 26.674999999999997 26.400000000000002 41 22.5 26.950000000000003 24.875 25.674999999999997 42 21.8 24.525 26.5 27.175 43 22.625 25.775 24.625 26.974999999999998 44 23.674999999999997 26.125 25.0 25.2 45 22.75 24.625 24.325 28.299999999999997 46 22.15 25.900000000000002 25.0 26.950000000000003 47 22.175 26.700000000000003 23.125 28.000000000000004 48 22.85 26.375 25.224999999999998 25.55 49 22.1 26.35 24.15 27.400000000000002 50 22.900000000000002 26.424999999999997 24.65 26.025 51 22.0 26.1 25.224999999999998 26.674999999999997 52 22.8 26.375 24.375 26.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 1.0 20 6.0 21 11.0 22 11.0 23 11.0 24 13.5 25 16.0 26 21.5 27 27.0 28 26.0 29 25.0 30 41.0 31 57.0 32 64.5 33 72.0 34 88.5 35 105.0 36 118.5 37 132.0 38 153.5 39 203.0 40 231.0 41 235.5 42 240.0 43 288.0 44 336.0 45 338.5 46 341.0 47 326.5 48 312.0 49 325.0 50 338.0 51 329.0 52 320.0 53 305.5 54 291.0 55 258.0 56 225.0 57 218.5 58 212.0 59 178.5 60 145.0 61 131.5 62 118.0 63 101.0 64 66.5 65 49.0 66 42.0 67 35.0 68 30.0 69 25.0 70 22.0 71 19.0 72 16.0 73 13.0 74 11.5 75 10.0 76 8.5 77 7.0 78 7.0 79 7.0 80 4.5 81 2.0 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 1.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.57263379910361 91.57499999999999 2 2.4255206960189826 4.6 3 0.47455839704719216 1.35 4 0.3427366200896388 1.3 5 0.05272871078302136 0.25 6 0.02636435539151068 0.15 7 0.07909306617453203 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.02636435539151068 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 10 0.25 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 7 0.17500000000000002 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 7 0.17500000000000002 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 7 0.17500000000000002 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra Read 200000 spots for SRR5423326.sra Written 200000 spots for SRR5423326.sra SRR ids: ['SRR5423326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_izfumqdw SRR5423326.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423326 file size 704012 SRR5423326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423326 SRR5423326_1.fastq Input file: SRR5423326_1.fastq trimmed: SRR5423326-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:39:49 2025 >> started Wed Feb 12 07:39:52 2025 >> done (2.780s) 4000000 reads processed; of these: 106 ( 0.00%) short reads filtered out after trimming by size control 66 ( 0.00%) empty reads filtered out after trimming by size control 3999828 (100.00%) reads available; of these: 161504 ( 4.04%) trimmed reads available after processing 3838324 (95.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 7 0.00% 26 12 0.00% 27 13 0.00% 28 6 0.00% 29 12 0.00% 30 13 0.00% 31 22 0.00% 32 19 0.00% 33 20 0.00% 34 34 0.00% 35 48 0.00% 36 72 0.00% 37 67 0.00% 38 56 0.00% 39 94 0.00% 40 135 0.00% 41 173 0.00% 42 212 0.01% 43 262 0.01% 44 452 0.01% 45 543 0.01% 46 816 0.02% 47 1297 0.03% 48 2350 0.06% 49 5175 0.13% 50 16621 0.42% 51 132954 3.32% 52 3838324 95.96% 3999828 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.46 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:40:05 Started mapping on | Feb 12 07:40:06 Finished on | Feb 12 07:40:18 Mapping speed, Million of reads per hour | 1199.95 Number of input reads | 3999828 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3289761 Uniquely mapped reads % | 82.25% Average mapped length | 51.73 Number of splices: Total | 312613 Number of splices: Annotated (sjdb) | 308346 Number of splices: GT/AG | 305512 Number of splices: GC/AG | 5627 Number of splices: AT/AC | 506 Number of splices: Non-canonical | 968 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465987 % of reads mapped to multiple loci | 11.65% Number of reads mapped to too many loci | 122293 % of reads mapped to too many loci | 3.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 244080 244080 244080 N_multimapping 465987 465987 465987 N_noFeature 613609 3220476 671023 N_ambiguous 25015 218 12936 UnstrandedReadsAssigned:2651137 PositiveStrandReadsAssigned:69067 NegativeStrandReadsAssigned:2605802 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423326 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423326-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,828 reads, 2,822,018 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR5423326.ke.tsv 34699 SRR5423326.se.tsv 87100 total ==> SRR5423326.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 81 15.4474 Potri.005G024800.1.v4.1 1035 936 1.00135 0.391524 Potri.004G059700.1.v4.1 961 862 3 1.27368 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 52.1222 6.70717 Potri.016G087400.1.v4.1 270 171 18 38.5232 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 36 15.0056 ==> SRR5423326.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423326 completed mapping pipeline successfully