Starting /dee2/code/volunteer_pipeline.sh SRR5423327 current disk space = 3049750491136 free memory = 1579958060 SRR5423327 SRAfilesize 74c72187141d17ac84a879155c4daee6 SRR5423327.sra SRR5423327.sra file validated SRR5423327 is single end SRR5423327 is conventional basespace SRR5423327 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423327_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50675 34.0 31.0 34.0 31.0 34.0 2 32.6015 34.0 31.0 34.0 31.0 34.0 3 32.60325 34.0 31.0 34.0 31.0 34.0 4 36.05325 37.0 35.0 37.0 35.0 37.0 5 36.04125 37.0 35.0 37.0 35.0 37.0 6 36.014 37.0 35.0 37.0 35.0 37.0 7 36.00075 37.0 35.0 37.0 35.0 37.0 8 36.006 37.0 35.0 37.0 35.0 37.0 9 37.80675 39.0 38.0 39.0 35.0 39.0 10 37.72425 39.0 38.0 39.0 35.0 39.0 11 37.7715 39.0 38.0 39.0 35.0 39.0 12 37.83825 39.0 38.0 39.0 35.0 39.0 13 37.7495 39.0 38.0 39.0 35.0 39.0 14 39.0595 40.0 38.0 41.0 36.0 41.0 15 39.12325 40.0 39.0 41.0 36.0 41.0 16 38.9945 40.0 39.0 41.0 36.0 41.0 17 39.0775 40.0 39.0 41.0 36.0 41.0 18 38.95925 40.0 38.0 41.0 36.0 41.0 19 39.07925 40.0 39.0 41.0 36.0 41.0 20 39.0065 40.0 39.0 41.0 35.0 41.0 21 38.97975 40.0 39.0 41.0 35.0 41.0 22 38.93525 40.0 38.0 41.0 35.0 41.0 23 38.76525 40.0 38.0 41.0 35.0 41.0 24 38.83475 40.0 39.0 41.0 35.0 41.0 25 38.69775 40.0 38.0 41.0 34.0 41.0 26 38.4445 40.0 38.0 41.0 34.0 41.0 27 38.32225 40.0 38.0 41.0 33.0 41.0 28 38.3535 40.0 38.0 41.0 34.0 41.0 29 38.20225 40.0 38.0 41.0 33.0 41.0 30 38.29525 40.0 38.0 41.0 34.0 41.0 31 38.3095 40.0 38.0 41.0 34.0 41.0 32 38.06975 40.0 38.0 41.0 33.0 41.0 33 37.98625 40.0 38.0 41.0 33.0 41.0 34 37.93375 40.0 38.0 41.0 33.0 41.0 35 37.86675 40.0 38.0 41.0 32.0 41.0 36 37.795 40.0 38.0 41.0 33.0 41.0 37 37.7435 40.0 38.0 41.0 32.0 41.0 38 37.5245 40.0 37.0 41.0 32.0 41.0 39 37.465 40.0 37.0 41.0 31.0 41.0 40 37.37875 40.0 37.0 41.0 31.0 41.0 41 37.2255 40.0 37.0 41.0 30.0 41.0 42 37.32825 40.0 37.0 41.0 31.0 41.0 43 37.0345 40.0 37.0 41.0 30.0 41.0 44 36.9305 40.0 36.0 41.0 30.0 41.0 45 36.84025 40.0 36.0 41.0 30.0 41.0 46 36.9295 40.0 36.0 41.0 30.0 41.0 47 36.853 40.0 36.0 41.0 30.0 41.0 48 36.717 40.0 36.0 41.0 29.0 41.0 49 36.67275 40.0 36.0 41.0 29.0 41.0 50 36.4515 39.0 36.0 41.0 28.0 41.0 51 36.2335 39.0 35.0 41.0 28.0 41.0 52 34.0435 38.0 32.0 40.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2202 1 0.0 2202 2 0.0 2202 3 0.0 2202 4 0.0 2202 5 0.0 2202 6 0.0 2202 7 0.0 2202 8 0.0 2202 9 0.0 2202 10 0.0 2202 11 0.0 2202 12 0.0 2202 13 0.0 2202 14 0.0 2202 15 0.0 2202 16 0.0 2202 17 0.0 2202 18 0.0 2202 19 0.0 2202 20 0.0 2202 21 0.0 2202 22 0.0 2202 23 0.0 2202 24 0.0 2202 25 0.0 2202 26 0.0 2202 27 0.0 2202 28 0.0 2202 29 0.0 2202 30 0.0 2202 31 0.0 2202 32 0.0 2202 33 0.0 2202 34 0.0 2202 35 0.0 2202 36 0.0 2202 37 0.0 2202 38 0.0 2202 39 0.0 2202 40 0.0 2202 41 0.0 2202 42 0.0 2202 43 0.0 2202 44 0.0 2202 45 0.0 2202 46 0.0 2202 47 0.0 2202 48 0.0 2202 49 0.0 2202 50 0.0 2202 51 0.0 2202 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 3.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 3.0 21 8.0 22 5.0 23 7.0 24 16.0 25 14.0 26 30.0 27 24.0 28 32.0 29 44.0 30 57.0 31 77.0 32 80.0 33 90.0 34 143.0 35 203.0 36 295.0 37 403.0 38 714.0 39 1745.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8066132264529 10.896793587174349 5.31062124248497 42.985971943887776 2 24.125 13.05 35.075 27.750000000000004 3 21.3 17.375 24.099999999999998 37.225 4 25.35 25.3 21.075 28.275 5 24.425 31.025000000000002 23.175 21.375 6 19.875 32.800000000000004 24.675 22.650000000000002 7 15.0 22.7 43.25 19.05 8 18.175 20.25 31.624999999999996 29.95 9 18.25 21.675 33.85 26.224999999999998 10 20.200000000000003 36.725 23.5 19.575 11 23.925 26.0 21.625 28.449999999999996 12 22.95 23.674999999999997 26.325 27.05 13 21.2 27.125 26.974999999999998 24.7 14 21.075 26.875 26.974999999999998 25.074999999999996 15 22.0 25.275 27.450000000000003 25.275 16 21.5 24.65 26.700000000000003 27.150000000000002 17 22.05 26.75 25.324999999999996 25.874999999999996 18 23.375 27.150000000000002 25.5 23.974999999999998 19 22.725 26.55 25.775 24.95 20 21.25 26.5 26.775 25.474999999999998 21 22.0 25.35 26.650000000000002 26.0 22 23.075000000000003 26.025 25.3 25.6 23 22.125 25.900000000000002 26.075 25.900000000000002 24 22.25 26.775 24.925 26.05 25 22.35 26.700000000000003 25.224999999999998 25.724999999999998 26 23.35 25.15 24.8 26.700000000000003 27 23.200000000000003 26.025 25.624999999999996 25.15 28 22.7 26.200000000000003 25.275 25.825 29 21.85 26.35 27.950000000000003 23.849999999999998 30 22.325 25.2 25.55 26.924999999999997 31 22.525000000000002 26.025 26.424999999999997 25.025 32 21.6 26.1 26.700000000000003 25.6 33 22.3 25.825 25.474999999999998 26.400000000000002 34 22.400000000000002 25.674999999999997 25.624999999999996 26.3 35 22.225 26.575 23.175 28.025 36 21.625 25.15 26.5 26.724999999999998 37 21.9 24.474999999999998 26.375 27.250000000000004 38 23.200000000000003 25.15 24.675 26.974999999999998 39 22.825 25.75 26.125 25.3 40 22.05 25.85 25.775 26.325 41 21.349999999999998 26.424999999999997 25.575 26.650000000000002 42 22.2 26.75 24.775 26.275 43 23.575 25.174999999999997 25.374999999999996 25.874999999999996 44 21.95 24.325 26.724999999999998 27.0 45 21.94145609206905 24.568426319739807 26.54490868151113 26.945208906680012 46 22.942206654991242 24.818613960470355 24.943707780835627 27.295471603702776 47 22.466850137603203 25.594195646735052 24.59344508381286 27.34550913184889 48 22.81711283462597 25.719289467100324 26.09457092819615 25.369026770077557 49 22.511255627813906 25.062531265632813 24.61230615307654 27.813906953476735 50 21.83591795897949 26.413206603301653 24.787393696848426 26.96348174087044 51 23.092319239429575 24.11808856642482 25.344008006004504 27.445584188141105 52 22.475 25.924999999999997 24.625 26.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 3.0 16 2.0 17 1.0 18 1.5 19 2.0 20 4.0 21 6.0 22 7.0 23 8.0 24 11.0 25 14.0 26 19.5 27 25.0 28 28.0 29 31.0 30 42.0 31 53.0 32 60.0 33 67.0 34 82.0 35 97.0 36 126.5 37 156.0 38 156.5 39 187.5 40 218.0 41 240.5 42 263.0 43 283.0 44 303.0 45 291.5 46 280.0 47 292.0 48 304.0 49 316.0 50 328.0 51 329.5 52 331.0 53 316.0 54 301.0 55 270.5 56 240.0 57 233.0 58 226.0 59 202.5 60 179.0 61 154.5 62 130.0 63 109.5 64 76.0 65 63.0 66 47.5 67 32.0 68 31.0 69 30.0 70 23.0 71 16.0 72 15.5 73 15.0 74 11.5 75 8.0 76 9.0 77 10.0 78 8.0 79 6.0 80 4.0 81 2.0 82 2.5 83 3.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.075 46 0.075 47 0.075 48 0.075 49 0.05 50 0.05 51 0.075 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.28947368421052 91.475 2 2.763157894736842 5.25 3 0.631578947368421 1.7999999999999998 4 0.15789473684210525 0.6 5 0.10526315789473684 0.5 6 0.02631578947368421 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02631578947368421 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 9 0.22499999999999998 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 6 0.15 No Hit ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra Read 200000 spots for SRR5423327.sra Written 200000 spots for SRR5423327.sra SRR ids: ['SRR5423327.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tt3k2_1l SRR5423327.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423327 file size 703963 SRR5423327 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423327 SRR5423327_1.fastq Input file: SRR5423327_1.fastq trimmed: SRR5423327-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:41:06 2025 >> started Wed Feb 12 07:41:08 2025 >> done (1.958s) 4000000 reads processed; of these: 113 ( 0.00%) short reads filtered out after trimming by size control 52 ( 0.00%) empty reads filtered out after trimming by size control 3999835 (100.00%) reads available; of these: 123581 ( 3.09%) trimmed reads available after processing 3876254 (96.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 9 0.00% 24 6 0.00% 25 7 0.00% 26 11 0.00% 27 19 0.00% 28 14 0.00% 29 19 0.00% 30 22 0.00% 31 41 0.00% 32 45 0.00% 33 66 0.00% 34 57 0.00% 35 64 0.00% 36 90 0.00% 37 105 0.00% 38 127 0.00% 39 188 0.00% 40 221 0.01% 41 270 0.01% 42 390 0.01% 43 473 0.01% 44 852 0.02% 45 1057 0.03% 46 1334 0.03% 47 1843 0.05% 48 3144 0.08% 49 6272 0.16% 50 16428 0.41% 51 90389 2.26% 52 3876254 96.91% 3999835 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=23.37 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:41:21 Started mapping on | Feb 12 07:41:21 Finished on | Feb 12 07:41:29 Mapping speed, Million of reads per hour | 1799.93 Number of input reads | 3999835 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305007 Uniquely mapped reads % | 82.63% Average mapped length | 51.75 Number of splices: Total | 318263 Number of splices: Annotated (sjdb) | 313904 Number of splices: GT/AG | 310832 Number of splices: GC/AG | 5954 Number of splices: AT/AC | 491 Number of splices: Non-canonical | 986 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462949 % of reads mapped to multiple loci | 11.57% Number of reads mapped to too many loci | 121998 % of reads mapped to too many loci | 3.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231879 231879 231879 N_multimapping 462949 462949 462949 N_noFeature 615343 3233962 674714 N_ambiguous 24806 186 12979 UnstrandedReadsAssigned:2664858 PositiveStrandReadsAssigned:70859 NegativeStrandReadsAssigned:2617314 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423327 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423327-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,835 reads, 2,972,123 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR5423327.ke.tsv 34699 SRR5423327.se.tsv 87100 total ==> SRR5423327.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 92 16.5642 Potri.005G024800.1.v4.1 1035 936 2.00272 0.739271 Potri.004G059700.1.v4.1 961 862 5 2.00411 Potri.007G009000.2.v4.1 1416 1317 1 0.262345 Potri.003G141000.2.v4.1 2943 2844 64.9268 7.88775 Potri.016G087400.1.v4.1 270 171 28 56.5745 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.206397 Potri.012G127500.1.v4.1 977 878 32 12.5926 ==> SRR5423327.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423327 completed mapping pipeline successfully