Starting /dee2/code/volunteer_pipeline.sh SRR5423328 current disk space = 3049835524096 free memory = 1442647488 SRR5423328 SRAfilesize 4da25c4b68d5d7e627cf9cfe20f9971f SRR5423328.sra SRR5423328.sra file validated SRR5423328 is single end SRR5423328 is conventional basespace SRR5423328 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423328_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.736 34.0 31.0 34.0 25.0 34.0 2 31.14675 34.0 31.0 34.0 26.0 34.0 3 32.14525 34.0 31.0 34.0 28.0 34.0 4 35.78325 37.0 35.0 37.0 35.0 37.0 5 35.8855 37.0 35.0 37.0 35.0 37.0 6 35.856 37.0 35.0 37.0 35.0 37.0 7 35.96725 37.0 35.0 37.0 35.0 37.0 8 35.9065 37.0 35.0 37.0 35.0 37.0 9 37.696 39.0 37.0 39.0 35.0 39.0 10 37.676 39.0 37.0 39.0 35.0 39.0 11 37.677 39.0 37.0 39.0 35.0 39.0 12 37.6745 39.0 37.0 39.0 35.0 39.0 13 37.5855 39.0 37.0 39.0 35.0 39.0 14 39.086 40.0 38.0 41.0 36.0 41.0 15 38.939 40.0 38.0 41.0 36.0 41.0 16 38.93375 40.0 38.0 41.0 36.0 41.0 17 38.88025 40.0 38.0 41.0 35.0 41.0 18 38.801 40.0 38.0 41.0 35.0 41.0 19 38.807 40.0 38.0 41.0 34.0 41.0 20 38.80025 40.0 38.0 41.0 35.0 41.0 21 38.75975 40.0 38.0 41.0 35.0 41.0 22 38.768 40.0 38.0 41.0 35.0 41.0 23 38.6835 40.0 38.0 41.0 34.0 41.0 24 38.57825 40.0 38.0 41.0 34.0 41.0 25 38.467 40.0 38.0 41.0 34.0 41.0 26 38.252 40.0 38.0 41.0 34.0 41.0 27 38.26675 40.0 38.0 41.0 33.0 41.0 28 37.944 40.0 38.0 41.0 33.0 41.0 29 38.0815 40.0 38.0 41.0 33.0 41.0 30 38.00025 40.0 38.0 41.0 33.0 41.0 31 38.0055 40.0 38.0 41.0 33.0 41.0 32 37.6485 40.0 37.0 41.0 32.0 41.0 33 37.5545 40.0 37.0 41.0 31.0 41.0 34 37.47775 40.0 37.0 41.0 31.0 41.0 35 37.57425 40.0 37.0 41.0 32.0 41.0 36 37.32975 40.0 37.0 41.0 30.0 41.0 37 37.25675 40.0 37.0 41.0 30.0 41.0 38 37.0675 40.0 37.0 41.0 30.0 41.0 39 37.09425 40.0 37.0 41.0 30.0 41.0 40 37.08975 40.0 37.0 41.0 30.0 41.0 41 37.0065 40.0 36.0 41.0 30.0 41.0 42 37.066 40.0 36.0 41.0 30.0 41.0 43 36.78375 40.0 36.0 41.0 30.0 41.0 44 36.63475 40.0 36.0 41.0 29.0 41.0 45 36.359 39.0 36.0 41.0 28.0 41.0 46 36.24125 39.0 35.0 41.0 27.0 41.0 47 36.01275 39.0 35.0 41.0 27.0 41.0 48 35.9955 39.0 35.0 41.0 26.0 41.0 49 36.03575 39.0 35.0 41.0 27.0 41.0 50 35.89425 39.0 35.0 41.0 26.0 41.0 51 35.7885 39.0 35.0 41.0 26.0 41.0 52 33.4995 37.0 31.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 4.0 20 2.0 21 6.0 22 7.0 23 16.0 24 23.0 25 28.0 26 26.0 27 27.0 28 30.0 29 55.0 30 73.0 31 84.0 32 112.0 33 126.0 34 155.0 35 232.0 36 290.0 37 431.0 38 833.0 39 1435.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.202795286379825 10.824883529734173 6.851192107426693 42.121129076459304 2 24.0 13.850000000000001 34.599999999999994 27.55 3 23.025000000000002 17.025000000000002 22.95 37.0 4 26.200000000000003 25.4 20.599999999999998 27.800000000000004 5 25.4 30.9 23.025000000000002 20.674999999999997 6 20.150000000000002 31.574999999999996 25.45 22.825 7 16.400000000000002 22.325 42.65 18.625 8 18.125 21.099999999999998 31.974999999999998 28.799999999999997 9 19.475 20.549999999999997 32.324999999999996 27.650000000000002 10 19.125 36.175000000000004 25.0 19.7 11 23.325000000000003 28.7 21.349999999999998 26.625 12 22.75 24.525 26.474999999999998 26.25 13 21.05 26.775 26.900000000000002 25.275 14 21.05 26.650000000000002 27.575 24.725 15 21.2 24.75 27.700000000000003 26.35 16 21.975 26.75 25.75 25.525 17 22.075 26.525 25.374999999999996 26.025 18 22.275 25.674999999999997 25.4 26.650000000000002 19 21.25 26.474999999999998 26.05 26.224999999999998 20 22.3 26.6 25.974999999999998 25.124999999999996 21 21.675 26.05 25.474999999999998 26.8 22 21.925 26.150000000000002 25.5 26.424999999999997 23 22.125 24.8 26.05 27.025 24 22.325 25.05 26.474999999999998 26.150000000000002 25 23.275000000000002 25.0 25.85 25.874999999999996 26 23.575 25.900000000000002 26.05 24.474999999999998 27 22.825 25.35 26.075 25.75 28 22.7 25.275 27.1 24.925 29 22.025 25.15 28.449999999999996 24.375 30 22.1 24.2 27.0 26.700000000000003 31 22.875 25.624999999999996 25.8 25.7 32 23.95 25.0 26.174999999999997 24.875 33 22.325 25.1 25.7 26.875 34 22.1 26.825 25.924999999999997 25.15 35 22.525000000000002 24.525 26.575 26.375 36 21.925 25.874999999999996 24.75 27.450000000000003 37 21.65 25.4 26.5 26.450000000000003 38 23.775 23.95 25.8 26.474999999999998 39 23.0 24.0 25.674999999999997 27.325 40 22.6 26.474999999999998 24.775 26.150000000000002 41 23.325000000000003 25.624999999999996 24.75 26.3 42 22.775000000000002 23.849999999999998 25.8 27.575 43 23.0 26.1 24.75 26.150000000000002 44 22.725 25.75 25.724999999999998 25.8 45 23.3 24.375 25.474999999999998 26.85 46 24.325 24.525 24.525 26.625 47 23.75 25.45 25.05 25.75 48 22.55 24.325 25.55 27.575 49 23.1 23.875 26.900000000000002 26.125 50 22.650000000000002 25.775 24.55 27.025 51 22.875 24.675 24.4 28.050000000000004 52 23.225 25.85 25.974999999999998 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 1.0 6 2.0 7 1.5 8 1.0 9 1.0 10 1.0 11 1.5 12 2.0 13 2.0 14 1.5 15 1.0 16 3.5 17 6.0 18 3.5 19 1.0 20 0.5 21 0.0 22 5.0 23 10.0 24 12.5 25 15.0 26 18.0 27 21.0 28 32.5 29 44.0 30 49.0 31 54.0 32 56.0 33 58.0 34 79.0 35 100.0 36 120.5 37 141.0 38 148.5 39 183.0 40 210.0 41 229.5 42 249.0 43 261.5 44 274.0 45 291.5 46 309.0 47 323.0 48 337.0 49 324.0 50 311.0 51 316.5 52 322.0 53 321.0 54 320.0 55 285.5 56 251.0 57 232.5 58 214.0 59 193.0 60 172.0 61 147.0 62 122.0 63 104.0 64 79.5 65 73.0 66 60.0 67 47.0 68 35.5 69 24.0 70 21.0 71 18.0 72 15.5 73 13.0 74 12.5 75 12.0 76 9.5 77 7.0 78 6.0 79 5.0 80 4.0 81 3.0 82 2.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.774999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 97.4811737211114 93.85 2 1.8436769670215527 3.55 3 0.33757465593352376 0.975 4 0.18177096857958971 0.7000000000000001 5 0.051934562451311346 0.25 6 0.051934562451311346 0.3 7 0.025967281225655673 0.17500000000000002 8 0.025967281225655673 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 8 0.2 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 6 0.15 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 6 0.15 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 5 0.125 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra Read 200000 spots for SRR5423328.sra Written 200000 spots for SRR5423328.sra SRR ids: ['SRR5423328.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ru9gf1l SRR5423328.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423328 file size 703963 SRR5423328 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423328 SRR5423328_1.fastq Input file: SRR5423328_1.fastq trimmed: SRR5423328-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:35:13 2025 >> started Wed Feb 12 07:35:15 2025 >> done (2.454s) 4000000 reads processed; of these: 133 ( 0.00%) short reads filtered out after trimming by size control 181 ( 0.00%) empty reads filtered out after trimming by size control 3999686 (99.99%) reads available; of these: 123312 ( 3.08%) trimmed reads available after processing 3876374 (96.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 15 0.00% 28 13 0.00% 29 21 0.00% 30 28 0.00% 31 16 0.00% 32 41 0.00% 33 41 0.00% 34 52 0.00% 35 61 0.00% 36 85 0.00% 37 121 0.00% 38 120 0.00% 39 172 0.00% 40 235 0.01% 41 285 0.01% 42 360 0.01% 43 458 0.01% 44 674 0.02% 45 957 0.02% 46 1097 0.03% 47 1704 0.04% 48 2832 0.07% 49 5715 0.14% 50 15421 0.39% 51 92745 2.32% 52 3876374 96.92% 3999686 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=19 prefix-density=0.31 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=20.72 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:35:26 Started mapping on | Feb 12 07:35:26 Finished on | Feb 12 07:35:32 Mapping speed, Million of reads per hour | 2399.81 Number of input reads | 3999686 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292592 Uniquely mapped reads % | 82.32% Average mapped length | 51.76 Number of splices: Total | 320587 Number of splices: Annotated (sjdb) | 316254 Number of splices: GT/AG | 313004 Number of splices: GC/AG | 6180 Number of splices: AT/AC | 501 Number of splices: Non-canonical | 902 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455090 % of reads mapped to multiple loci | 11.38% Number of reads mapped to too many loci | 139927 % of reads mapped to too many loci | 3.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 252004 252004 252004 N_multimapping 455090 455090 455090 N_noFeature 605093 3215093 670571 N_ambiguous 25130 234 12891 UnstrandedReadsAssigned:2662369 PositiveStrandReadsAssigned:77265 NegativeStrandReadsAssigned:2609130 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423328 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423328-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,686 reads, 2,964,022 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR5423328.ke.tsv 34699 SRR5423328.se.tsv 87100 total ==> SRR5423328.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 83 15.033 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 8 3.22571 Potri.007G009000.2.v4.1 1416 1317 1 0.26391 Potri.003G141000.2.v4.1 2943 2844 66.8269 8.16702 Potri.016G087400.1.v4.1 270 171 28 56.912 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.415257 Potri.012G127500.1.v4.1 977 878 16 6.33384 ==> SRR5423328.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423328 completed mapping pipeline successfully