Starting /dee2/code/volunteer_pipeline.sh SRR5423329 current disk space = 3049968754688 free memory = 962690820 SRR5423329 SRAfilesize 1384935e9013c18f0db9bca3affcf09b SRR5423329.sra SRR5423329.sra file validated SRR5423329 is single end SRR5423329 is conventional basespace SRR5423329 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.69675 31.0 30.0 33.0 28.0 34.0 2 31.24275 31.0 31.0 34.0 28.0 34.0 3 31.31775 31.0 31.0 34.0 28.0 34.0 4 29.82325 35.0 26.0 37.0 16.0 37.0 5 33.508 35.0 33.0 37.0 28.0 37.0 6 34.4045 35.0 35.0 37.0 31.0 37.0 7 34.8185 35.0 35.0 37.0 32.0 37.0 8 35.02925 36.0 35.0 37.0 32.0 37.0 9 36.7685 39.0 37.0 39.0 32.0 39.0 10 36.68975 39.0 35.0 39.0 32.0 39.0 11 36.62125 39.0 35.0 39.0 32.0 39.0 12 36.513 39.0 35.0 39.0 32.0 39.0 13 36.39525 38.0 35.0 39.0 32.0 39.0 14 37.63125 39.0 37.0 41.0 32.0 41.0 15 37.85825 40.0 37.0 41.0 32.0 41.0 16 37.86825 40.0 37.0 41.0 32.0 41.0 17 37.80225 40.0 37.0 41.0 32.0 41.0 18 37.72375 39.0 37.0 41.0 33.0 41.0 19 37.8705 40.0 37.0 41.0 33.0 41.0 20 37.6765 39.0 37.0 41.0 32.0 41.0 21 37.882 39.0 37.0 41.0 33.0 41.0 22 37.7705 39.0 37.0 41.0 33.0 41.0 23 37.75125 39.0 37.0 41.0 32.0 41.0 24 37.65925 39.0 37.0 41.0 32.0 41.0 25 37.7855 40.0 37.0 41.0 33.0 41.0 26 37.70625 40.0 37.0 41.0 32.0 41.0 27 37.61225 40.0 37.0 41.0 32.0 41.0 28 37.52 40.0 37.0 41.0 32.0 41.0 29 37.438 39.0 37.0 41.0 31.0 41.0 30 37.431 39.0 37.0 41.0 31.0 41.0 31 37.3285 39.0 36.0 41.0 31.0 41.0 32 37.49525 39.0 37.0 41.0 32.0 41.0 33 37.6295 39.0 37.0 41.0 32.0 41.0 34 37.3135 39.0 36.0 41.0 31.0 41.0 35 37.36525 39.0 36.0 41.0 31.0 41.0 36 37.42175 39.0 36.0 41.0 31.0 41.0 37 37.315 39.0 36.0 41.0 31.0 41.0 38 37.3705 39.0 36.0 41.0 31.0 41.0 39 37.21275 39.0 36.0 41.0 31.0 41.0 40 37.1515 39.0 36.0 40.0 31.0 41.0 41 36.84875 39.0 35.0 40.0 30.0 41.0 42 36.89175 39.0 35.0 40.0 30.0 41.0 43 36.86375 39.0 35.0 40.0 31.0 41.0 44 36.686 39.0 35.0 40.0 30.0 41.0 45 36.4205 38.0 35.0 40.0 30.0 41.0 46 36.097 38.0 35.0 40.0 29.0 41.0 47 36.405 38.0 35.0 40.0 30.0 41.0 48 36.31425 38.0 35.0 40.0 29.0 41.0 49 36.3395 38.0 35.0 40.0 30.0 41.0 50 35.68475 38.0 34.0 40.0 28.0 41.0 51 35.915 38.0 34.0 40.0 29.0 41.0 52 35.38 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 1.0 23 10.0 24 15.0 25 11.0 26 22.0 27 27.0 28 57.0 29 62.0 30 99.0 31 107.0 32 165.0 33 195.0 34 257.0 35 310.0 36 435.0 37 537.0 38 804.0 39 880.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.26039058587882 11.592388582874312 7.01051577366049 41.13670505758638 2 26.5 13.15 32.5 27.85 3 23.400000000000002 17.775 22.95 35.875 4 26.25 25.124999999999996 23.05 25.575 5 25.15 31.525 23.35 19.975 6 18.375 33.650000000000006 23.65 24.325 7 14.924999999999999 22.400000000000002 42.75 19.925 8 18.575 21.55 31.1 28.775000000000002 9 19.375 20.849999999999998 33.275 26.5 10 19.75 35.5 24.349999999999998 20.4 11 22.825 27.250000000000004 22.900000000000002 27.025 12 21.775 23.75 26.75 27.725 13 20.05 26.275 28.15 25.525 14 20.674999999999997 28.199999999999996 26.375 24.75 15 20.4 26.674999999999997 28.050000000000004 24.875 16 21.0 26.400000000000002 26.950000000000003 25.650000000000002 17 23.225 25.25 25.825 25.7 18 22.225 25.0 26.575 26.200000000000003 19 22.650000000000002 26.85 24.375 26.125 20 21.5 26.700000000000003 25.75 26.05 21 21.725 26.700000000000003 25.900000000000002 25.674999999999997 22 22.0 26.375 25.724999999999998 25.900000000000002 23 20.925 27.6 25.55 25.924999999999997 24 21.975 26.900000000000002 25.45 25.674999999999997 25 22.125 26.825 24.15 26.900000000000002 26 23.0 25.674999999999997 26.3 25.025 27 22.425 25.924999999999997 26.125 25.525 28 21.725 26.700000000000003 25.874999999999996 25.7 29 21.65 27.700000000000003 26.950000000000003 23.7 30 22.900000000000002 26.075 25.825 25.2 31 21.8 26.1 25.525 26.575 32 21.975 25.95 25.624999999999996 26.450000000000003 33 21.775 25.35 25.55 27.325 34 21.15 25.95 26.900000000000002 26.0 35 21.125 26.775 24.7 27.400000000000002 36 20.05 24.925 26.924999999999997 28.1 37 21.725 26.55 26.525 25.2 38 21.925 25.85 25.3 26.924999999999997 39 22.0 24.85 24.7 28.449999999999996 40 22.225 24.925 26.525 26.325 41 21.175 26.5 26.5 25.825 42 23.05 25.1 25.900000000000002 25.95 43 23.400000000000002 25.224999999999998 25.374999999999996 26.0 44 23.325000000000003 25.174999999999997 25.05 26.450000000000003 45 22.325 25.025 25.724999999999998 26.924999999999997 46 23.425 25.35 25.825 25.4 47 24.4 23.674999999999997 25.75 26.174999999999997 48 22.55 25.074999999999996 26.25 26.125 49 23.025000000000002 25.724999999999998 24.625 26.625 50 24.224999999999998 25.35 24.775 25.650000000000002 51 21.25 26.375 24.725 27.650000000000002 52 22.3 26.950000000000003 24.725 26.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 2.0 11 1.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 4.5 19 7.0 20 7.0 21 7.0 22 7.0 23 7.0 24 13.0 25 19.0 26 20.5 27 22.0 28 25.0 29 28.0 30 40.5 31 53.0 32 66.0 33 79.0 34 86.5 35 94.0 36 114.5 37 135.0 38 159.0 39 202.5 40 222.0 41 244.5 42 267.0 43 273.5 44 280.0 45 291.5 46 303.0 47 304.5 48 306.0 49 348.0 50 390.0 51 343.5 52 297.0 53 284.5 54 272.0 55 258.0 56 244.0 57 224.5 58 205.0 59 179.0 60 153.0 61 149.0 62 145.0 63 120.0 64 79.5 65 64.0 66 50.0 67 36.0 68 30.5 69 25.0 70 21.0 71 17.0 72 13.0 73 9.0 74 10.0 75 11.0 76 8.5 77 6.0 78 5.5 79 5.0 80 3.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.26491273769211 93.35 2 1.8754884084396979 3.5999999999999996 3 0.44282365199270646 1.275 4 0.28653295128939826 1.0999999999999999 5 0.07814535035165407 0.375 6 0.052096900234436055 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 6 0.15 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 6 0.15 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra Read 200000 spots for SRR5423329.sra Written 200000 spots for SRR5423329.sra SRR ids: ['SRR5423329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r722zfjm SRR5423329.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423329 file size 704016 SRR5423329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423329 SRR5423329_1.fastq Input file: SRR5423329_1.fastq trimmed: SRR5423329-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:14:12 2025 >> started Wed Feb 12 07:14:14 2025 >> done (1.932s) 4000000 reads processed; of these: 179 ( 0.00%) short reads filtered out after trimming by size control 209 ( 0.01%) empty reads filtered out after trimming by size control 3999612 (99.99%) reads available; of these: 99866 ( 2.50%) trimmed reads available after processing 3899746 (97.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 6 0.00% 24 2 0.00% 25 5 0.00% 26 7 0.00% 27 8 0.00% 28 14 0.00% 29 13 0.00% 30 21 0.00% 31 23 0.00% 32 24 0.00% 33 41 0.00% 34 42 0.00% 35 72 0.00% 36 86 0.00% 37 88 0.00% 38 83 0.00% 39 153 0.00% 40 177 0.00% 41 194 0.00% 42 281 0.01% 43 291 0.01% 44 547 0.01% 45 626 0.02% 46 893 0.02% 47 1444 0.04% 48 2404 0.06% 49 4684 0.12% 50 12337 0.31% 51 75282 1.88% 52 3899746 97.50% 3999612 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=22 prefix-density=0.30 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=14.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.1 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGAT Started job on | Feb 12 07:14:27 Started mapping on | Feb 12 07:14:28 Finished on | Feb 12 07:14:38 Mapping speed, Million of reads per hour | 1439.86 Number of input reads | 3999612 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3290922 Uniquely mapped reads % | 82.28% Average mapped length | 51.77 Number of splices: Total | 320279 Number of splices: Annotated (sjdb) | 316071 Number of splices: GT/AG | 312651 Number of splices: GC/AG | 6177 Number of splices: AT/AC | 516 Number of splices: Non-canonical | 935 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453485 % of reads mapped to multiple loci | 11.34% Number of reads mapped to too many loci | 143251 % of reads mapped to too many loci | 3.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 255205 255205 255205 N_multimapping 453485 453485 453485 N_noFeature 607035 3212281 673408 N_ambiguous 25286 194 12837 UnstrandedReadsAssigned:2658601 PositiveStrandReadsAssigned:78447 NegativeStrandReadsAssigned:2604677 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423329 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423329-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,612 reads, 2,942,794 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR5423329.ke.tsv 34699 SRR5423329.se.tsv 87100 total ==> SRR5423329.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 84 15.3032 Potri.005G024800.1.v4.1 1035 936 1 0.37351 Potri.004G059700.1.v4.1 961 862 10 4.05575 Potri.007G009000.2.v4.1 1416 1317 1 0.265456 Potri.003G141000.2.v4.1 2943 2844 57.6466 7.08635 Potri.016G087400.1.v4.1 270 171 27 55.2009 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 32 12.7419 ==> SRR5423329.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 34 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423329 completed mapping pipeline successfully