Starting /dee2/code/volunteer_pipeline.sh SRR5423330 current disk space = 3049736957952 free memory = 1435314292 SRR5423330 SRAfilesize 4bdbc287856663ed9635a784daff019d SRR5423330.sra SRR5423330.sra file validated SRR5423330 is single end SRR5423330 is conventional basespace SRR5423330 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423330_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83475 33.0 31.0 34.0 30.0 34.0 2 32.1305 34.0 31.0 34.0 30.0 34.0 3 32.16725 34.0 31.0 34.0 30.0 34.0 4 35.714 37.0 35.0 37.0 33.0 37.0 5 35.6865 37.0 35.0 37.0 33.0 37.0 6 35.5465 37.0 35.0 37.0 33.0 37.0 7 35.72475 37.0 35.0 37.0 35.0 37.0 8 35.518 37.0 35.0 37.0 33.0 37.0 9 37.26625 39.0 37.0 39.0 34.0 39.0 10 37.11825 39.0 37.0 39.0 33.0 39.0 11 37.14375 39.0 37.0 39.0 33.0 39.0 12 37.1265 39.0 37.0 39.0 33.0 39.0 13 37.1695 39.0 37.0 39.0 33.0 39.0 14 38.449 40.0 38.0 41.0 33.0 41.0 15 38.36 40.0 38.0 41.0 33.0 41.0 16 38.3295 40.0 38.0 41.0 33.0 41.0 17 38.407 40.0 38.0 41.0 33.0 41.0 18 38.36025 40.0 38.0 41.0 33.0 41.0 19 38.221 40.0 38.0 41.0 33.0 41.0 20 38.38425 40.0 38.0 41.0 34.0 41.0 21 38.1235 40.0 38.0 41.0 33.0 41.0 22 38.219 40.0 38.0 41.0 33.0 41.0 23 38.2135 40.0 38.0 41.0 33.0 41.0 24 38.0895 40.0 37.0 41.0 33.0 41.0 25 38.05475 40.0 37.0 41.0 33.0 41.0 26 38.023 40.0 37.0 41.0 33.0 41.0 27 37.99025 40.0 38.0 41.0 33.0 41.0 28 37.84225 40.0 37.0 41.0 33.0 41.0 29 37.89875 40.0 37.0 41.0 32.0 41.0 30 37.86925 40.0 38.0 41.0 32.0 41.0 31 37.736 40.0 37.0 41.0 32.0 41.0 32 37.508 40.0 37.0 41.0 31.0 41.0 33 37.67425 40.0 37.0 41.0 31.0 41.0 34 37.57225 40.0 37.0 41.0 32.0 41.0 35 37.54475 40.0 37.0 41.0 31.0 41.0 36 37.67575 40.0 37.0 41.0 32.0 41.0 37 37.55825 40.0 37.0 41.0 32.0 41.0 38 37.50425 40.0 37.0 41.0 32.0 41.0 39 37.5315 40.0 37.0 41.0 32.0 41.0 40 37.26875 40.0 36.0 41.0 31.0 41.0 41 37.206 40.0 36.0 41.0 31.0 41.0 42 37.07325 39.0 36.0 41.0 30.0 41.0 43 36.94975 39.0 36.0 41.0 30.0 41.0 44 37.15225 39.0 36.0 41.0 31.0 41.0 45 37.15025 39.0 36.0 41.0 31.0 41.0 46 36.84025 39.0 35.0 41.0 30.0 41.0 47 36.69275 39.0 35.0 41.0 30.0 41.0 48 36.58125 39.0 35.0 40.0 30.0 41.0 49 36.55675 39.0 35.0 40.0 30.0 41.0 50 36.51625 39.0 35.0 40.0 30.0 41.0 51 36.34475 39.0 35.0 40.0 29.0 41.0 52 35.185 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 5.0 22 8.0 23 6.0 24 9.0 25 18.0 26 22.0 27 33.0 28 47.0 29 54.0 30 71.0 31 84.0 32 119.0 33 138.0 34 177.0 35 234.0 36 313.0 37 482.0 38 783.0 39 1395.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.43565348022033 10.015022533800702 7.361041562343515 42.18828242363546 2 25.724999999999998 14.524999999999999 31.7 28.050000000000004 3 23.525 17.599999999999998 22.75 36.125 4 26.974999999999998 25.1 22.025 25.900000000000002 5 26.224999999999998 29.275000000000002 24.05 20.45 6 19.1 32.725 24.425 23.75 7 14.899999999999999 22.375 42.9 19.825 8 19.125 21.325 31.2 28.349999999999998 9 18.625 20.974999999999998 33.4 27.0 10 19.75 36.575 24.675 19.0 11 24.9 26.05 21.099999999999998 27.950000000000003 12 22.85 23.65 25.6 27.900000000000002 13 20.775 27.224999999999998 27.400000000000002 24.6 14 21.875 25.5 27.0 25.624999999999996 15 21.125 25.575 27.525 25.775 16 21.825 26.075 26.150000000000002 25.95 17 22.6 25.124999999999996 26.1 26.174999999999997 18 22.375 25.874999999999996 25.05 26.700000000000003 19 21.725 25.224999999999998 26.125 26.924999999999997 20 22.275 25.874999999999996 26.1 25.75 21 20.68017004251063 25.581395348837212 26.881720430107524 26.85671417854464 22 21.775 26.525 25.374999999999996 26.325 23 22.85 25.8 24.775 26.575 24 22.15 25.6 24.9 27.35 25 21.125 26.674999999999997 25.324999999999996 26.875 26 22.75 25.45 26.450000000000003 25.35 27 23.25 25.6 25.424999999999997 25.724999999999998 28 22.325 26.125 26.625 24.925 29 22.2 25.35 27.525 24.925 30 21.8 24.95 25.15 28.1 31 22.45 25.825 26.275 25.45 32 23.925 25.1 24.875 26.1 33 22.35 25.0 25.124999999999996 27.525 34 22.85 25.674999999999997 25.2 26.275 35 22.55 24.65 25.15 27.650000000000002 36 22.75 24.55 24.925 27.775 37 21.125 25.75 25.75 27.375 38 23.3 24.65 24.224999999999998 27.825 39 23.0 25.124999999999996 25.25 26.625 40 23.200000000000003 26.400000000000002 25.874999999999996 24.525 41 24.75 25.3 24.75 25.2 42 22.8 25.2 25.624999999999996 26.375 43 22.53063265816454 26.25656414103526 24.93123280820205 26.281570392598148 44 22.475 25.275 26.1 26.150000000000002 45 22.650000000000002 24.675 26.25 26.424999999999997 46 23.330832708177045 25.831457864466117 25.03125781445361 25.806451612903224 47 24.15 24.775 25.174999999999997 25.900000000000002 48 22.455613903475868 24.20605151287822 26.556639159789945 26.78169542385596 49 23.13078269567392 25.63140785196299 24.956239059764943 26.281570392598148 50 23.680920230057513 25.506376594148538 24.60615153788447 26.206551637909474 51 21.73043260815204 25.35633908477119 24.781195298824706 28.132033008252062 52 22.55563890972743 26.131532883220803 25.331332833208304 25.98149537384346 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 3.0 21 2.0 22 8.0 23 14.0 24 14.0 25 14.0 26 20.0 27 26.0 28 33.0 29 40.0 30 37.5 31 35.0 32 55.5 33 76.0 34 86.0 35 96.0 36 106.5 37 117.0 38 138.0 39 179.5 40 200.0 41 234.0 42 268.0 43 259.5 44 251.0 45 284.5 46 318.0 47 314.5 48 311.0 49 313.5 50 316.0 51 315.5 52 315.0 53 332.0 54 349.0 55 309.5 56 270.0 57 237.0 58 204.0 59 194.5 60 185.0 61 148.5 62 112.0 63 110.0 64 89.5 65 71.0 66 58.0 67 45.0 68 36.5 69 28.0 70 22.5 71 17.0 72 15.5 73 14.0 74 14.0 75 14.0 76 10.0 77 6.0 78 5.5 79 5.0 80 4.0 81 3.0 82 2.0 83 1.0 84 1.5 85 2.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.68769716088327 91.95 2 2.4710830704521554 4.7 3 0.36803364879074657 1.05 4 0.2103049421661409 0.8 5 0.13144058885383808 0.625 6 0.052576235541535225 0.3 7 0.052576235541535225 0.35000000000000003 8 0.0 0.0 9 0.026288117770767613 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 9 0.22499999999999998 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 7 0.17500000000000002 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 7 0.17500000000000002 No Hit CAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCCCT 6 0.15 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 6 0.15 No Hit GTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGT 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra Read 200000 spots for SRR5423330.sra Written 200000 spots for SRR5423330.sra SRR ids: ['SRR5423330.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jtou56c9 SRR5423330.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423330 file size 703955 SRR5423330 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423330 SRR5423330_1.fastq Input file: SRR5423330_1.fastq trimmed: SRR5423330-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 07:42:57 2025 >> started Wed Feb 12 07:42:59 2025 >> done (2.149s) 4000000 reads processed; of these: 142 ( 0.00%) short reads filtered out after trimming by size control 242 ( 0.01%) empty reads filtered out after trimming by size control 3999616 (99.99%) reads available; of these: 80722 ( 2.02%) trimmed reads available after processing 3918894 (97.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 12 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 2 0.00% 29 7 0.00% 30 3 0.00% 31 9 0.00% 32 17 0.00% 33 24 0.00% 34 31 0.00% 35 38 0.00% 36 37 0.00% 37 49 0.00% 38 61 0.00% 39 81 0.00% 40 117 0.00% 41 147 0.00% 42 183 0.00% 43 209 0.01% 44 378 0.01% 45 522 0.01% 46 651 0.02% 47 1000 0.03% 48 1701 0.04% 49 3687 0.09% 50 9723 0.24% 51 62000 1.55% 52 3918894 97.98% 3999616 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=25.02 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 07:43:10 Started mapping on | Feb 12 07:43:10 Finished on | Feb 12 07:43:15 Mapping speed, Million of reads per hour | 2879.72 Number of input reads | 3999616 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3289478 Uniquely mapped reads % | 82.24% Average mapped length | 51.78 Number of splices: Total | 319184 Number of splices: Annotated (sjdb) | 314974 Number of splices: GT/AG | 311584 Number of splices: GC/AG | 6125 Number of splices: AT/AC | 515 Number of splices: Non-canonical | 960 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452995 % of reads mapped to multiple loci | 11.33% Number of reads mapped to too many loci | 146614 % of reads mapped to too many loci | 3.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257143 257143 257143 N_multimapping 452995 452995 452995 N_noFeature 607478 3210479 674097 N_ambiguous 25514 219 12930 UnstrandedReadsAssigned:2656486 PositiveStrandReadsAssigned:78780 NegativeStrandReadsAssigned:2602451 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423330 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423330-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,616 reads, 2,965,600 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR5423330.ke.tsv 34699 SRR5423330.se.tsv 87100 total ==> SRR5423330.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 87 15.7289 Potri.005G024800.1.v4.1 1035 936 1 0.370661 Potri.004G059700.1.v4.1 961 862 9.68243 3.897 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 77.2104 9.41887 Potri.016G087400.1.v4.1 270 171 25 50.7221 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.207251 Potri.012G127500.1.v4.1 977 878 26 10.2738 ==> SRR5423330.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 34 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423330 completed mapping pipeline successfully