Starting /dee2/code/volunteer_pipeline.sh SRR5423331 current disk space = 3050615992320 free memory = 1466209196 SRR5423331 SRAfilesize 38b03ec9fd48d4dbc3cd207fa81b2c10 SRR5423331.sra SRR5423331.sra file validated SRR5423331 is single end SRR5423331 is conventional basespace SRR5423331 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07925 33.0 31.0 34.0 30.0 34.0 2 32.231 34.0 31.0 34.0 30.0 34.0 3 32.296 34.0 31.0 34.0 30.0 34.0 4 35.75825 37.0 35.0 37.0 33.0 37.0 5 35.71875 37.0 35.0 37.0 33.0 37.0 6 35.73475 37.0 35.0 37.0 33.0 37.0 7 35.82925 37.0 35.0 37.0 35.0 37.0 8 35.8095 37.0 35.0 37.0 35.0 37.0 9 37.31425 39.0 37.0 39.0 34.0 39.0 10 37.4595 39.0 37.0 39.0 35.0 39.0 11 37.3965 39.0 37.0 39.0 34.0 39.0 12 37.55475 39.0 37.0 39.0 35.0 39.0 13 37.445 39.0 37.0 39.0 34.0 39.0 14 38.69575 40.0 38.0 41.0 34.0 41.0 15 38.593 40.0 38.0 41.0 34.0 41.0 16 38.56075 40.0 38.0 41.0 34.0 41.0 17 38.407 40.0 38.0 41.0 33.0 41.0 18 38.52925 40.0 38.0 41.0 34.0 41.0 19 38.60125 40.0 38.0 41.0 34.0 41.0 20 38.66075 40.0 38.0 41.0 34.0 41.0 21 38.5335 40.0 38.0 41.0 34.0 41.0 22 38.58025 40.0 38.0 41.0 34.0 41.0 23 38.556 40.0 38.0 41.0 34.0 41.0 24 38.4765 40.0 38.0 41.0 34.0 41.0 25 38.544 40.0 38.0 41.0 34.0 41.0 26 38.47275 40.0 38.0 41.0 34.0 41.0 27 38.3795 40.0 38.0 41.0 34.0 41.0 28 38.2895 40.0 38.0 41.0 34.0 41.0 29 38.34125 40.0 38.0 41.0 34.0 41.0 30 38.17275 40.0 38.0 41.0 33.0 41.0 31 38.13375 40.0 38.0 41.0 33.0 41.0 32 38.02325 40.0 38.0 41.0 33.0 41.0 33 38.09425 40.0 38.0 41.0 33.0 41.0 34 37.78575 40.0 37.0 41.0 32.0 41.0 35 38.004 40.0 38.0 41.0 33.0 41.0 36 37.85525 40.0 38.0 41.0 33.0 41.0 37 37.89375 40.0 37.0 41.0 33.0 41.0 38 37.8805 40.0 37.0 41.0 33.0 41.0 39 37.926 40.0 37.0 41.0 33.0 41.0 40 37.78425 40.0 37.0 41.0 33.0 41.0 41 37.7045 40.0 37.0 41.0 32.0 41.0 42 37.52475 40.0 37.0 41.0 32.0 41.0 43 37.4695 40.0 37.0 41.0 32.0 41.0 44 37.31475 40.0 36.0 41.0 31.0 41.0 45 37.25225 40.0 36.0 41.0 31.0 41.0 46 37.128 39.0 36.0 41.0 31.0 41.0 47 37.191 39.0 36.0 41.0 31.0 41.0 48 37.131 39.0 35.0 41.0 31.0 41.0 49 36.9935 39.0 35.0 41.0 31.0 41.0 50 37.06625 39.0 35.0 41.0 31.0 41.0 51 36.91725 39.0 35.0 41.0 31.0 41.0 52 35.6985 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1307 1 0.0 1307 2 0.0 1307 3 0.0 1307 4 0.0 1307 5 0.0 1307 6 0.0 1307 7 0.0 1307 8 0.0 1307 9 0.0 1307 10 0.0 1307 11 0.0 1307 12 0.0 1307 13 0.0 1307 14 0.0 1307 15 0.0 1307 16 0.0 1307 17 0.0 1307 18 0.0 1307 19 0.0 1307 20 0.0 1307 21 0.0 1307 22 0.0 1307 23 0.0 1307 24 0.0 1307 25 0.0 1307 26 0.0 1307 27 0.0 1307 28 0.0 1307 29 0.0 1307 30 0.0 1307 31 0.0 1307 32 0.0 1307 33 0.0 1307 34 0.0 1307 35 0.0 1307 36 0.0 1307 37 0.0 1307 38 0.0 1307 39 0.0 1307 40 0.0 1307 41 0.0 1307 42 0.0 1307 43 0.0 1307 44 0.0 1307 45 0.0 1307 46 0.0 1307 47 0.0 1307 48 0.0 1307 49 0.0 1307 50 0.0 1307 51 0.0 1307 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 3.0 24 12.0 25 11.0 26 13.0 27 23.0 28 38.0 29 45.0 30 58.0 31 81.0 32 97.0 33 128.0 34 153.0 35 224.0 36 315.0 37 456.0 38 723.0 39 1607.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.34302179904786 9.120521172638437 6.8654472563267355 42.671009771986974 2 23.724999999999998 13.55 34.925 27.800000000000004 3 23.45 16.375 23.275000000000002 36.9 4 26.25 24.7 20.474999999999998 28.575 5 24.875 31.75 22.75 20.625 6 19.85 31.8 24.25 24.099999999999998 7 15.55 22.325 41.8 20.325 8 19.075 21.325 30.25 29.349999999999998 9 18.925 19.900000000000002 34.575 26.6 10 19.3 34.65 25.3 20.75 11 23.150000000000002 26.974999999999998 23.35 26.525 12 23.775 22.125 26.75 27.35 13 21.875 25.2 28.1 24.825 14 21.65 27.35 27.150000000000002 23.849999999999998 15 21.925 25.650000000000002 27.975 24.45 16 22.425 24.55 27.05 25.974999999999998 17 22.025 25.825 26.25 25.900000000000002 18 22.35 25.2 26.150000000000002 26.3 19 21.925 26.424999999999997 25.124999999999996 26.525 20 21.15 25.650000000000002 27.325 25.874999999999996 21 21.25 25.474999999999998 26.325 26.950000000000003 22 22.725 25.55 25.624999999999996 26.1 23 21.85 26.8 25.825 25.525 24 22.55 25.525 24.825 27.1 25 23.275000000000002 26.625 24.025 26.075 26 23.400000000000002 25.55 24.474999999999998 26.575 27 22.15 25.124999999999996 26.775 25.95 28 22.975 25.575 26.974999999999998 24.474999999999998 29 22.375 26.075 27.200000000000003 24.349999999999998 30 22.125 24.45 27.325 26.1 31 23.075000000000003 25.224999999999998 25.35 26.35 32 22.45 26.05 25.75 25.75 33 22.025 24.875 27.700000000000003 25.4 34 21.875 24.875 26.400000000000002 26.85 35 21.725 25.775 25.575 26.924999999999997 36 23.7 25.900000000000002 25.174999999999997 25.224999999999998 37 21.5 26.700000000000003 24.55 27.250000000000004 38 22.775000000000002 24.925 25.6 26.700000000000003 39 21.525 25.0 26.224999999999998 27.250000000000004 40 22.6 25.924999999999997 25.674999999999997 25.8 41 24.2 24.25 24.825 26.724999999999998 42 22.125 24.6 25.75 27.525 43 23.200000000000003 25.6 25.05 26.150000000000002 44 22.55 25.025 26.075 26.35 45 22.075 24.45 27.325 26.150000000000002 46 23.875 23.400000000000002 25.825 26.900000000000002 47 22.900000000000002 25.45 26.125 25.525 48 22.45 24.975 25.575 27.0 49 22.55 24.75 25.575 27.125 50 22.575 25.2 26.400000000000002 25.825 51 22.975 25.674999999999997 24.474999999999998 26.875 52 22.925 24.474999999999998 25.874999999999996 26.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 4.0 18 4.0 19 4.0 20 4.0 21 4.0 22 7.5 23 11.0 24 11.5 25 12.0 26 16.5 27 21.0 28 26.0 29 31.0 30 31.5 31 32.0 32 51.5 33 71.0 34 89.5 35 108.0 36 108.0 37 108.0 38 138.5 39 185.5 40 202.0 41 241.5 42 281.0 43 280.0 44 279.0 45 301.5 46 324.0 47 317.0 48 310.0 49 319.0 50 328.0 51 321.5 52 315.0 53 316.5 54 318.0 55 283.5 56 249.0 57 237.5 58 226.0 59 193.0 60 160.0 61 155.0 62 150.0 63 118.0 64 79.5 65 73.0 66 60.0 67 47.0 68 37.0 69 27.0 70 23.5 71 20.0 72 13.0 73 6.0 74 6.5 75 7.0 76 6.0 77 5.0 78 6.0 79 7.0 80 3.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.30021141649048 91.10000000000001 2 2.536997885835095 4.8 3 0.6871035940803383 1.95 4 0.21141649048625794 0.8 5 0.21141649048625794 1.0 6 0.0 0.0 7 0.052854122621564484 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 7 0.17500000000000002 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 7 0.17500000000000002 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 5 0.125 No Hit GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 5 0.125 No Hit GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 5 0.125 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra Read 200000 spots for SRR5423331.sra Written 200000 spots for SRR5423331.sra SRR ids: ['SRR5423331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q97wrcze SRR5423331.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423331 file size 703967 SRR5423331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423331 SRR5423331_1.fastq Input file: SRR5423331_1.fastq trimmed: SRR5423331-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:58 2025 >> started Wed Feb 12 21:41:59 2025 >> done (1.559s) 4000000 reads processed; of these: 166 ( 0.00%) short reads filtered out after trimming by size control 254 ( 0.01%) empty reads filtered out after trimming by size control 3999580 (99.99%) reads available; of these: 83945 ( 2.10%) trimmed reads available after processing 3915635 (97.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 4 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 2 0.00% 28 6 0.00% 29 6 0.00% 30 6 0.00% 31 8 0.00% 32 13 0.00% 33 24 0.00% 34 34 0.00% 35 34 0.00% 36 49 0.00% 37 53 0.00% 38 67 0.00% 39 89 0.00% 40 99 0.00% 41 115 0.00% 42 156 0.00% 43 191 0.00% 44 302 0.01% 45 429 0.01% 46 601 0.02% 47 906 0.02% 48 1655 0.04% 49 3656 0.09% 50 10514 0.26% 51 64880 1.62% 52 3915635 97.90% 3999580 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=21.54 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:42:12 Started mapping on | Feb 12 21:42:13 Finished on | Feb 12 21:42:19 Mapping speed, Million of reads per hour | 2399.75 Number of input reads | 3999580 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3289229 Uniquely mapped reads % | 82.24% Average mapped length | 51.78 Number of splices: Total | 319933 Number of splices: Annotated (sjdb) | 315682 Number of splices: GT/AG | 312276 Number of splices: GC/AG | 6212 Number of splices: AT/AC | 504 Number of splices: Non-canonical | 941 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452725 % of reads mapped to multiple loci | 11.32% Number of reads mapped to too many loci | 147561 % of reads mapped to too many loci | 3.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257626 257626 257626 N_multimapping 452725 452725 452725 N_noFeature 608742 3210663 675054 N_ambiguous 25320 202 12881 UnstrandedReadsAssigned:2655167 PositiveStrandReadsAssigned:78364 NegativeStrandReadsAssigned:2601294 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423331 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423331-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,580 reads, 2,963,356 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR5423331.ke.tsv 34699 SRR5423331.se.tsv 87100 total ==> SRR5423331.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 84.6073 15.2921 Potri.005G024800.1.v4.1 1035 936 1 0.370559 Potri.004G059700.1.v4.1 961 862 9 3.62133 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 62.6888 7.64529 Potri.016G087400.1.v4.1 270 171 36 73.0196 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 26 10.271 ==> SRR5423331.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423331 completed mapping pipeline successfully