Starting /dee2/code/volunteer_pipeline.sh SRR5423332 current disk space = 3050498187264 free memory = 1580308612 SRR5423332 SRAfilesize 0deffbfbb653991e96e1f46fe3386c00 SRR5423332.sra SRR5423332.sra file validated SRR5423332 is single end SRR5423332 is conventional basespace SRR5423332 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56975 34.0 31.0 34.0 31.0 34.0 2 32.58025 34.0 31.0 34.0 31.0 34.0 3 32.69225 34.0 31.0 34.0 31.0 34.0 4 36.1645 37.0 37.0 37.0 35.0 37.0 5 36.1625 37.0 37.0 37.0 35.0 37.0 6 36.0895 37.0 35.0 37.0 35.0 37.0 7 36.0965 37.0 35.0 37.0 35.0 37.0 8 36.02775 37.0 35.0 37.0 35.0 37.0 9 37.81225 39.0 38.0 39.0 35.0 39.0 10 37.6965 39.0 37.0 39.0 35.0 39.0 11 37.71425 39.0 37.0 39.0 35.0 39.0 12 37.704 39.0 38.0 39.0 35.0 39.0 13 37.6045 39.0 37.0 39.0 35.0 39.0 14 38.99675 40.0 38.0 41.0 36.0 41.0 15 38.99375 40.0 38.0 41.0 36.0 41.0 16 39.01275 40.0 38.0 41.0 35.0 41.0 17 38.99275 40.0 38.0 41.0 35.0 41.0 18 38.8925 40.0 38.0 41.0 36.0 41.0 19 38.88825 40.0 38.0 41.0 35.0 41.0 20 38.87225 40.0 38.0 41.0 35.0 41.0 21 38.977 40.0 39.0 41.0 35.0 41.0 22 38.9345 40.0 38.0 41.0 35.0 41.0 23 38.896 40.0 38.0 41.0 35.0 41.0 24 38.86225 40.0 38.0 41.0 35.0 41.0 25 38.8825 40.0 38.0 41.0 35.0 41.0 26 38.7235 40.0 38.0 41.0 35.0 41.0 27 38.5835 40.0 38.0 41.0 34.0 41.0 28 38.4675 40.0 38.0 41.0 34.0 41.0 29 38.37675 40.0 38.0 41.0 34.0 41.0 30 38.446 40.0 38.0 41.0 34.0 41.0 31 38.37 40.0 38.0 41.0 34.0 41.0 32 38.4105 40.0 38.0 41.0 34.0 41.0 33 38.1985 40.0 38.0 41.0 33.0 41.0 34 38.037 40.0 38.0 41.0 33.0 41.0 35 37.89275 40.0 38.0 41.0 33.0 41.0 36 37.92825 40.0 38.0 41.0 33.0 41.0 37 37.912 40.0 38.0 41.0 33.0 41.0 38 37.9335 40.0 38.0 41.0 33.0 41.0 39 37.91725 40.0 38.0 41.0 33.0 41.0 40 37.7345 40.0 37.0 41.0 32.0 41.0 41 37.75575 40.0 37.0 41.0 32.0 41.0 42 37.75675 40.0 37.0 41.0 32.0 41.0 43 37.782 40.0 37.0 41.0 33.0 41.0 44 37.63225 40.0 37.0 41.0 32.0 41.0 45 37.21475 40.0 36.0 41.0 31.0 41.0 46 37.15975 40.0 37.0 41.0 31.0 41.0 47 37.17625 40.0 36.0 41.0 31.0 41.0 48 37.10475 40.0 36.0 41.0 31.0 41.0 49 37.0985 40.0 36.0 41.0 31.0 41.0 50 37.00325 39.0 36.0 41.0 31.0 41.0 51 36.947 39.0 36.0 41.0 30.0 41.0 52 35.353 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2103 1 0.0 2103 2 0.0 2103 3 0.0 2103 4 0.0 2103 5 0.0 2103 6 0.0 2103 7 0.0 2103 8 0.0 2103 9 0.0 2103 10 0.0 2103 11 0.0 2103 12 0.0 2103 13 0.0 2103 14 0.0 2103 15 0.0 2103 16 0.0 2103 17 0.0 2103 18 0.0 2103 19 0.0 2103 20 0.0 2103 21 0.0 2103 22 0.0 2103 23 0.0 2103 24 0.0 2103 25 0.0 2103 26 0.0 2103 27 0.0 2103 28 0.0 2103 29 0.0 2103 30 0.0 2103 31 0.0 2103 32 0.0 2103 33 0.0 2103 34 0.0 2103 35 0.0 2103 36 0.0 2103 37 0.0 2103 38 0.0 2103 39 0.0 2103 40 0.0 2103 41 0.0 2103 42 0.0 2103 43 0.0 2103 44 0.0 2103 45 0.0 2103 46 0.0 2103 47 0.0 2103 48 0.0 2103 49 0.0 2103 50 0.0 2103 51 0.0 2103 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 1.0 20 3.0 21 2.0 22 2.0 23 12.0 24 10.0 25 12.0 26 21.0 27 19.0 28 29.0 29 30.0 30 58.0 31 61.0 32 87.0 33 107.0 34 145.0 35 182.0 36 263.0 37 425.0 38 750.0 39 1767.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.070535267633815 10.405202601300651 6.753376688344172 41.770885442721365 2 23.65 13.65 33.875 28.825 3 23.0 17.925 22.15 36.925000000000004 4 26.5 24.925 20.75 27.825 5 24.675 31.4 23.575 20.349999999999998 6 20.549999999999997 31.55 25.1 22.8 7 15.475 23.275000000000002 42.125 19.125 8 18.475 21.75 31.7 28.075 9 20.5 18.9 34.050000000000004 26.55 10 18.9 36.8 24.65 19.650000000000002 11 24.15 27.85 21.224999999999998 26.775 12 22.75 23.799999999999997 25.825 27.625 13 21.15 25.650000000000002 27.750000000000004 25.45 14 22.075 27.55 26.025 24.349999999999998 15 21.425 24.8 26.700000000000003 27.075 16 22.825 25.275 26.650000000000002 25.25 17 23.075000000000003 26.424999999999997 26.075 24.425 18 22.925 25.575 25.775 25.724999999999998 19 22.275 26.174999999999997 24.474999999999998 27.075 20 20.849999999999998 25.874999999999996 27.6 25.674999999999997 21 22.275 24.725 25.974999999999998 27.025 22 21.975 26.6 25.275 26.150000000000002 23 22.225 25.75 25.474999999999998 26.55 24 22.725 25.525 24.525 27.224999999999998 25 22.775000000000002 26.125 24.775 26.325 26 21.375 26.3 26.424999999999997 25.900000000000002 27 22.0 25.025 25.6 27.375 28 22.075 25.874999999999996 27.05 25.0 29 21.875 25.525 26.700000000000003 25.900000000000002 30 22.7 24.95 25.95 26.400000000000002 31 23.225 26.025 25.825 24.925 32 22.85 25.874999999999996 25.6 25.674999999999997 33 22.875 24.95 26.375 25.8 34 21.875 27.125 25.650000000000002 25.35 35 22.55 25.174999999999997 25.025 27.250000000000004 36 21.625 25.275 25.7 27.400000000000002 37 22.05 26.6 25.424999999999997 25.924999999999997 38 22.8 25.724999999999998 25.275 26.200000000000003 39 22.925 25.15 24.6 27.325 40 21.275 25.55 27.35 25.825 41 22.175 26.025 25.025 26.775 42 21.85 24.325 26.875 26.950000000000003 43 23.75 26.125 23.9 26.224999999999998 44 22.975 26.375 24.025 26.625 45 22.575 23.724999999999998 25.974999999999998 27.725 46 23.400000000000002 23.925 25.575 27.1 47 23.775 25.374999999999996 25.474999999999998 25.374999999999996 48 23.1 25.2 25.224999999999998 26.474999999999998 49 23.175 25.650000000000002 24.95 26.224999999999998 50 21.85 26.424999999999997 24.099999999999998 27.625 51 22.5 25.0 24.125 28.375 52 23.974999999999998 24.675 25.05 26.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.5 15 2.0 16 2.0 17 2.0 18 2.0 19 2.0 20 5.5 21 9.0 22 10.0 23 11.0 24 12.5 25 14.0 26 18.0 27 22.0 28 29.5 29 37.0 30 39.5 31 42.0 32 53.0 33 64.0 34 84.0 35 104.0 36 104.0 37 104.0 38 133.0 39 181.5 40 201.0 41 229.5 42 258.0 43 267.0 44 276.0 45 292.0 46 308.0 47 319.0 48 330.0 49 334.0 50 338.0 51 340.0 52 342.0 53 322.0 54 302.0 55 277.0 56 252.0 57 236.5 58 221.0 59 189.0 60 157.0 61 157.0 62 157.0 63 124.0 64 73.0 65 55.0 66 52.5 67 50.0 68 37.5 69 25.0 70 21.0 71 17.0 72 16.0 73 15.0 74 13.0 75 11.0 76 8.5 77 6.0 78 4.5 79 3.0 80 4.0 81 5.0 82 3.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 96.78100263852242 91.7 2 2.163588390501319 4.1000000000000005 3 0.47493403693931396 1.35 4 0.21108179419525064 0.8 5 0.15831134564643798 0.75 6 0.13192612137203166 0.75 7 0.05277044854881266 0.35000000000000003 8 0.02638522427440633 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 8 0.2 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 7 0.17500000000000002 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 6 0.15 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 6 0.15 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit GTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTA 6 0.15 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 5 0.125 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit CAGGGTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGG 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra Read 200000 spots for SRR5423332.sra Written 200000 spots for SRR5423332.sra SRR ids: ['SRR5423332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4wbgl3ld SRR5423332.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423332 file size 703984 SRR5423332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423332 SRR5423332_1.fastq Input file: SRR5423332_1.fastq trimmed: SRR5423332-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:24:13 2025 >> started Wed Feb 12 22:24:15 2025 >> done (1.999s) 4000000 reads processed; of these: 128 ( 0.00%) short reads filtered out after trimming by size control 226 ( 0.01%) empty reads filtered out after trimming by size control 3999646 (99.99%) reads available; of these: 83563 ( 2.09%) trimmed reads available after processing 3916083 (97.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 9 0.00% 27 6 0.00% 28 5 0.00% 29 8 0.00% 30 10 0.00% 31 12 0.00% 32 16 0.00% 33 21 0.00% 34 35 0.00% 35 33 0.00% 36 43 0.00% 37 58 0.00% 38 78 0.00% 39 92 0.00% 40 108 0.00% 41 171 0.00% 42 175 0.00% 43 217 0.01% 44 416 0.01% 45 509 0.01% 46 661 0.02% 47 994 0.02% 48 1678 0.04% 49 3842 0.10% 50 10036 0.25% 51 64305 1.61% 52 3916083 97.91% 3999646 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=20.82 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 22:24:28 Started mapping on | Feb 12 22:24:29 Finished on | Feb 12 22:24:35 Mapping speed, Million of reads per hour | 2399.79 Number of input reads | 3999646 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292562 Uniquely mapped reads % | 82.32% Average mapped length | 51.76 Number of splices: Total | 319439 Number of splices: Annotated (sjdb) | 315313 Number of splices: GT/AG | 311888 Number of splices: GC/AG | 6120 Number of splices: AT/AC | 495 Number of splices: Non-canonical | 936 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453416 % of reads mapped to multiple loci | 11.34% Number of reads mapped to too many loci | 143146 % of reads mapped to too many loci | 3.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253668 253668 253668 N_multimapping 453416 453416 453416 N_noFeature 608534 3213773 674974 N_ambiguous 25569 207 13023 UnstrandedReadsAssigned:2658459 PositiveStrandReadsAssigned:78582 NegativeStrandReadsAssigned:2604565 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423332 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423332-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,646 reads, 2,957,278 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR5423332.ke.tsv 34699 SRR5423332.se.tsv 87100 total ==> SRR5423332.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 89 16.1393 Potri.005G024800.1.v4.1 1035 936 4 1.48714 Potri.004G059700.1.v4.1 961 862 8 3.22962 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71.1965 8.71161 Potri.016G087400.1.v4.1 270 171 25 50.876 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 23 9.11596 ==> SRR5423332.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 30 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423332 completed mapping pipeline successfully