Starting /dee2/code/volunteer_pipeline.sh SRR5423333 current disk space = 3049665445888 free memory = 1432883572 SRR5423333 SRAfilesize f573c168be8ba11fca55719e67d0943d SRR5423333.sra SRR5423333.sra file validated SRR5423333 is single end SRR5423333 is conventional basespace SRR5423333 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423333_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.39575 31.0 30.0 33.0 26.0 34.0 2 30.726 31.0 30.0 33.0 27.0 34.0 3 31.2555 31.0 31.0 34.0 28.0 34.0 4 29.023 33.0 25.0 35.0 10.0 37.0 5 31.89775 35.0 30.0 37.0 19.0 37.0 6 33.893 35.0 33.0 37.0 30.0 37.0 7 34.774 35.0 35.0 37.0 32.0 37.0 8 34.95275 35.0 35.0 37.0 32.0 37.0 9 36.49 38.0 35.0 39.0 32.0 39.0 10 36.6105 38.0 35.0 39.0 32.0 39.0 11 36.534 39.0 35.0 39.0 32.0 39.0 12 36.52125 39.0 35.0 39.0 32.0 39.0 13 36.5905 39.0 35.0 39.0 32.0 39.0 14 37.5055 39.0 36.0 41.0 32.0 41.0 15 37.55725 39.0 36.0 41.0 32.0 41.0 16 37.58475 39.0 37.0 41.0 32.0 41.0 17 37.33775 39.0 36.0 41.0 32.0 41.0 18 37.33375 39.0 36.0 40.0 31.0 41.0 19 37.49075 39.0 36.0 40.0 32.0 41.0 20 37.771 39.0 37.0 41.0 32.0 41.0 21 37.75225 39.0 37.0 41.0 32.0 41.0 22 37.59775 39.0 37.0 41.0 32.0 41.0 23 37.70125 39.0 37.0 41.0 32.0 41.0 24 37.50425 39.0 36.0 41.0 32.0 41.0 25 37.46725 39.0 36.0 41.0 32.0 41.0 26 37.08925 39.0 36.0 40.0 31.0 41.0 27 37.36675 39.0 36.0 40.0 32.0 41.0 28 37.13975 39.0 36.0 40.0 31.0 41.0 29 37.15875 39.0 36.0 40.0 31.0 41.0 30 36.93925 39.0 36.0 40.0 30.0 41.0 31 37.0935 39.0 36.0 40.0 31.0 41.0 32 37.11 39.0 36.0 40.0 31.0 41.0 33 37.2135 39.0 36.0 40.0 31.0 41.0 34 37.05825 39.0 36.0 40.0 31.0 41.0 35 37.1355 39.0 36.0 40.0 31.0 41.0 36 37.19725 39.0 36.0 40.0 31.0 41.0 37 37.19825 39.0 36.0 40.0 31.0 41.0 38 36.87075 39.0 35.0 40.0 30.0 41.0 39 36.71 39.0 35.0 40.0 30.0 41.0 40 36.59925 39.0 35.0 40.0 30.0 41.0 41 36.72175 39.0 35.0 40.0 30.0 41.0 42 36.8145 39.0 35.0 40.0 30.0 41.0 43 36.418 39.0 35.0 40.0 30.0 41.0 44 36.453 38.0 35.0 40.0 30.0 41.0 45 36.47875 38.0 35.0 40.0 30.0 41.0 46 35.88975 38.0 34.0 40.0 28.0 41.0 47 35.835 38.0 34.0 40.0 28.0 41.0 48 35.92825 38.0 34.0 40.0 28.0 41.0 49 36.1305 38.0 35.0 40.0 29.0 41.0 50 35.898 38.0 34.0 40.0 28.0 41.0 51 35.9455 38.0 34.0 40.0 28.0 41.0 52 35.329 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2115 1 0.0 2115 2 0.0 2115 3 0.0 2115 4 0.0 2115 5 0.0 2115 6 0.0 2115 7 0.0 2115 8 0.0 2115 9 0.0 2115 10 0.0 2115 11 0.0 2115 12 0.0 2115 13 0.0 2115 14 0.0 2115 15 0.0 2115 16 0.0 2115 17 0.0 2115 18 0.0 2115 19 0.0 2115 20 0.0 2115 21 0.0 2115 22 0.0 2115 23 0.0 2115 24 0.0 2115 25 0.0 2115 26 0.0 2115 27 0.0 2115 28 0.0 2115 29 0.0 2115 30 0.0 2115 31 0.0 2115 32 0.0 2115 33 0.0 2115 34 0.0 2115 35 0.0 2115 36 0.0 2115 37 0.0 2115 38 0.0 2115 39 0.0 2115 40 0.0 2115 41 0.0 2115 42 0.0 2115 43 0.0 2115 44 0.0 2115 45 0.0 2115 46 0.0 2115 47 0.0 2115 48 0.0 2115 49 0.0 2115 50 0.0 2115 51 0.0 2115 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 3.0 23 10.0 24 14.0 25 22.0 26 20.0 27 40.0 28 59.0 29 72.0 30 108.0 31 136.0 32 174.0 33 200.0 34 272.0 35 358.0 36 438.0 37 566.0 38 708.0 39 793.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.43565348022033 10.691036554832248 7.436154231347021 41.4371557336004 2 24.825 14.124999999999998 32.824999999999996 28.225 3 22.975 18.5 23.925 34.599999999999994 4 27.0 24.55 22.925 25.525 5 25.124999999999996 30.175 23.575 21.125 6 19.05 34.699999999999996 24.45 21.8 7 15.875 23.400000000000002 41.375 19.35 8 19.075 22.1 29.175 29.65 9 17.575 21.325 33.550000000000004 27.55 10 19.425 36.0 24.875 19.7 11 23.875 26.125 21.975 28.025 12 21.575 23.7 26.125 28.599999999999998 13 20.599999999999998 26.35 28.000000000000004 25.05 14 20.875 27.375 26.025 25.724999999999998 15 21.125 26.25 27.325 25.3 16 22.275 26.950000000000003 26.0 24.775 17 22.650000000000002 25.4 26.650000000000002 25.3 18 22.375 25.650000000000002 25.775 26.200000000000003 19 20.674999999999997 27.200000000000003 26.075 26.05 20 21.45 25.45 26.35 26.75 21 22.05 25.525 25.624999999999996 26.8 22 21.9 26.474999999999998 24.675 26.950000000000003 23 22.75 26.125 24.375 26.75 24 22.425 26.025 25.55 26.0 25 22.3 26.224999999999998 26.3 25.174999999999997 26 22.400000000000002 25.95 26.0 25.650000000000002 27 22.0 26.200000000000003 26.875 24.925 28 22.25 26.025 26.700000000000003 25.025 29 21.025 25.224999999999998 28.000000000000004 25.75 30 21.375 26.724999999999998 27.075 24.825 31 23.3 26.275 25.15 25.275 32 21.3 26.075 27.175 25.45 33 22.8 24.6 24.875 27.725 34 21.675 24.625 26.275 27.425 35 21.325 25.275 26.025 27.375 36 21.0 25.55 25.275 28.175 37 22.2 25.55 25.474999999999998 26.775 38 21.75 25.124999999999996 26.025 27.1 39 20.95 24.525 26.575 27.950000000000003 40 21.775 26.724999999999998 25.924999999999997 25.575 41 22.95 24.725 24.474999999999998 27.85 42 22.7 24.525 26.150000000000002 26.625 43 22.625 26.150000000000002 25.650000000000002 25.575 44 22.625 24.85 26.200000000000003 26.325 45 21.95 25.25 25.374999999999996 27.425 46 23.325000000000003 25.025 25.974999999999998 25.674999999999997 47 25.0 23.775 25.7 25.525 48 22.375 25.474999999999998 24.55 27.6 49 20.955238809702426 27.181795448862218 26.18154538634659 25.681420355088775 50 22.650000000000002 25.8 25.174999999999997 26.375 51 22.95 25.224999999999998 25.6 26.224999999999998 52 23.575 25.025 24.5 26.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.5 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 3.0 19 4.0 20 6.0 21 8.0 22 8.0 23 8.0 24 10.0 25 12.0 26 15.5 27 19.0 28 30.0 29 41.0 30 43.5 31 46.0 32 66.0 33 86.0 34 87.5 35 89.0 36 107.0 37 125.0 38 155.5 39 201.5 40 217.0 41 239.5 42 262.0 43 270.0 44 278.0 45 296.5 46 315.0 47 328.0 48 341.0 49 322.5 50 304.0 51 311.0 52 318.0 53 316.0 54 314.0 55 285.0 56 256.0 57 218.5 58 181.0 59 175.5 60 170.0 61 152.0 62 134.0 63 111.5 64 77.0 65 65.0 66 55.0 67 45.0 68 35.5 69 26.0 70 22.5 71 19.0 72 17.0 73 15.0 74 10.5 75 6.0 76 6.0 77 6.0 78 3.5 79 1.0 80 1.0 81 1.0 82 1.5 83 2.0 84 2.5 85 3.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.025 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.339593114241 93.30000000000001 2 1.8257694314032342 3.5000000000000004 3 0.3651538862806468 1.05 4 0.1825769431403234 0.7000000000000001 5 0.2347417840375587 1.125 6 0.02608242044861763 0.15 7 0.02608242044861763 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 7 0.17500000000000002 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit CCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAACGGC 5 0.125 No Hit CCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGG 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra Read 200000 spots for SRR5423333.sra Written 200000 spots for SRR5423333.sra SRR ids: ['SRR5423333.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_hm2z9b SRR5423333.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423333 file size 703971 SRR5423333 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423333 SRR5423333_1.fastq Input file: SRR5423333_1.fastq trimmed: SRR5423333-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 08:01:02 2025 >> started Wed Feb 12 08:01:04 2025 >> done (1.917s) 4000000 reads processed; of these: 165 ( 0.00%) short reads filtered out after trimming by size control 196 ( 0.00%) empty reads filtered out after trimming by size control 3999639 (99.99%) reads available; of these: 100700 ( 2.52%) trimmed reads available after processing 3898939 (97.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 9 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 7 0.00% 26 11 0.00% 27 18 0.00% 28 11 0.00% 29 19 0.00% 30 24 0.00% 31 31 0.00% 32 35 0.00% 33 47 0.00% 34 58 0.00% 35 63 0.00% 36 75 0.00% 37 93 0.00% 38 102 0.00% 39 145 0.00% 40 167 0.00% 41 243 0.01% 42 301 0.01% 43 382 0.01% 44 621 0.02% 45 729 0.02% 46 949 0.02% 47 1491 0.04% 48 2458 0.06% 49 5172 0.13% 50 13527 0.34% 51 73897 1.85% 52 3898939 97.48% 3999639 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=20 prefix-density=0.30 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=30.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 08:01:14 Started mapping on | Feb 12 08:01:15 Finished on | Feb 12 08:01:21 Mapping speed, Million of reads per hour | 2399.78 Number of input reads | 3999639 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3291341 Uniquely mapped reads % | 82.29% Average mapped length | 51.77 Number of splices: Total | 319949 Number of splices: Annotated (sjdb) | 315816 Number of splices: GT/AG | 312327 Number of splices: GC/AG | 6174 Number of splices: AT/AC | 498 Number of splices: Non-canonical | 950 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454527 % of reads mapped to multiple loci | 11.36% Number of reads mapped to too many loci | 140829 % of reads mapped to too many loci | 3.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253771 253771 253771 N_multimapping 454527 454527 454527 N_noFeature 604330 3213048 670302 N_ambiguous 25408 228 12873 UnstrandedReadsAssigned:2661603 PositiveStrandReadsAssigned:78065 NegativeStrandReadsAssigned:2608166 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423333 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423333-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,639 reads, 2,962,613 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR5423333.ke.tsv 34699 SRR5423333.se.tsv 87100 total ==> SRR5423333.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 89 16.1245 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 7 2.82333 Potri.007G009000.2.v4.1 1416 1317 1 0.263989 Potri.003G141000.2.v4.1 2943 2844 72.0183 8.80409 Potri.016G087400.1.v4.1 270 171 27 54.8958 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.41538 Potri.012G127500.1.v4.1 977 878 35 13.8594 ==> SRR5423333.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423333 completed mapping pipeline successfully