Starting /dee2/code/volunteer_pipeline.sh SRR5423334 current disk space = 3050515251200 free memory = 1579618176 SRR5423334 SRAfilesize 25897e36ef7c810ab8cedb0b26540461 SRR5423334.sra SRR5423334.sra file validated SRR5423334 is single end SRR5423334 is conventional basespace SRR5423334 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9175 33.0 31.0 34.0 30.0 34.0 2 32.0885 34.0 31.0 34.0 30.0 34.0 3 32.09425 34.0 31.0 34.0 30.0 34.0 4 35.3835 37.0 35.0 37.0 33.0 37.0 5 35.59525 37.0 35.0 37.0 33.0 37.0 6 35.459 37.0 35.0 37.0 32.0 37.0 7 35.50125 37.0 35.0 37.0 33.0 37.0 8 35.64325 37.0 35.0 37.0 33.0 37.0 9 37.21125 39.0 37.0 39.0 33.0 39.0 10 37.13125 39.0 37.0 39.0 33.0 39.0 11 37.23825 39.0 37.0 39.0 33.0 39.0 12 37.198 39.0 37.0 39.0 34.0 39.0 13 37.004 39.0 37.0 39.0 33.0 39.0 14 38.2695 40.0 38.0 41.0 33.0 41.0 15 38.247 40.0 38.0 41.0 33.0 41.0 16 38.297 40.0 38.0 41.0 33.0 41.0 17 38.42325 40.0 38.0 41.0 34.0 41.0 18 38.2715 40.0 37.0 41.0 33.0 41.0 19 38.31975 40.0 38.0 41.0 34.0 41.0 20 38.197 40.0 38.0 41.0 33.0 41.0 21 38.0165 40.0 37.0 41.0 33.0 41.0 22 38.212 40.0 38.0 41.0 34.0 41.0 23 38.27025 40.0 38.0 41.0 34.0 41.0 24 38.245 40.0 38.0 41.0 33.0 41.0 25 38.2105 40.0 38.0 41.0 33.0 41.0 26 37.99675 40.0 37.0 41.0 33.0 41.0 27 38.01875 40.0 37.0 41.0 32.0 41.0 28 37.994 40.0 38.0 41.0 33.0 41.0 29 38.04 40.0 38.0 41.0 33.0 41.0 30 37.7225 40.0 37.0 41.0 32.0 41.0 31 37.84575 40.0 37.0 41.0 32.0 41.0 32 37.845 40.0 37.0 41.0 33.0 41.0 33 37.899 40.0 37.0 41.0 33.0 41.0 34 37.81575 40.0 37.0 41.0 33.0 41.0 35 37.562 40.0 37.0 41.0 31.0 41.0 36 37.525 40.0 37.0 41.0 31.0 41.0 37 37.48425 40.0 37.0 41.0 32.0 41.0 38 37.3805 40.0 36.0 41.0 31.0 41.0 39 37.25075 40.0 37.0 41.0 31.0 41.0 40 37.091 39.0 36.0 41.0 31.0 41.0 41 37.168 39.0 36.0 41.0 31.0 41.0 42 37.2415 40.0 36.0 41.0 31.0 41.0 43 37.1225 39.0 36.0 41.0 31.0 41.0 44 36.987 39.0 36.0 41.0 31.0 41.0 45 36.9365 39.0 36.0 41.0 31.0 41.0 46 36.88175 39.0 35.0 41.0 30.0 41.0 47 36.88775 39.0 35.0 41.0 30.0 41.0 48 37.02775 39.0 35.0 41.0 31.0 41.0 49 36.82825 39.0 35.0 41.0 30.0 41.0 50 36.71725 39.0 35.0 41.0 30.0 41.0 51 36.50575 39.0 35.0 40.0 30.0 41.0 52 35.59425 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2212 1 0.0 2212 2 0.0 2212 3 0.0 2212 4 0.0 2212 5 0.0 2212 6 0.0 2212 7 0.0 2212 8 0.0 2212 9 0.0 2212 10 0.0 2212 11 0.0 2212 12 0.0 2212 13 0.0 2212 14 0.0 2212 15 0.0 2212 16 0.0 2212 17 0.0 2212 18 0.0 2212 19 0.0 2212 20 0.0 2212 21 0.0 2212 22 0.0 2212 23 0.0 2212 24 0.0 2212 25 0.0 2212 26 0.0 2212 27 0.0 2212 28 0.0 2212 29 0.0 2212 30 0.0 2212 31 0.0 2212 32 0.0 2212 33 0.0 2212 34 0.0 2212 35 0.0 2212 36 0.0 2212 37 0.0 2212 38 0.0 2212 39 0.0 2212 40 0.0 2212 41 0.0 2212 42 0.0 2212 43 0.0 2212 44 0.0 2212 45 0.0 2212 46 0.0 2212 47 0.0 2212 48 0.0 2212 49 0.0 2212 50 0.0 2212 51 0.0 2212 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 0.0 22 3.0 23 8.0 24 16.0 25 11.0 26 23.0 27 33.0 28 39.0 29 57.0 30 69.0 31 77.0 32 113.0 33 124.0 34 207.0 35 254.0 36 335.0 37 490.0 38 765.0 39 1370.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.17543859649123 9.974937343358397 7.368421052631578 42.4812030075188 2 24.6 14.875 33.5 27.025 3 23.05 16.85 23.724999999999998 36.375 4 26.575 25.2 21.275 26.950000000000003 5 25.374999999999996 30.675 23.150000000000002 20.8 6 19.125 32.1 24.65 24.125 7 15.65 22.55 41.775 20.025000000000002 8 18.275 21.05 31.125000000000004 29.549999999999997 9 19.025 20.575 34.050000000000004 26.35 10 20.349999999999998 35.15 24.375 20.125 11 23.075000000000003 27.725 20.724999999999998 28.475 12 22.125 23.875 25.575 28.425 13 21.6 26.275 26.450000000000003 25.674999999999997 14 20.7 25.650000000000002 28.475 25.174999999999997 15 22.125 24.925 26.85 26.1 16 21.675 25.650000000000002 26.875 25.8 17 21.85 25.25 26.450000000000003 26.450000000000003 18 19.6 25.75 27.625 27.025 19 21.6 26.200000000000003 25.775 26.424999999999997 20 22.05 25.074999999999996 26.5 26.375 21 21.95 24.9 26.400000000000002 26.75 22 23.0 26.950000000000003 25.5 24.55 23 21.925 26.400000000000002 25.624999999999996 26.05 24 22.675 24.6 26.3 26.424999999999997 25 22.225 26.75 24.925 26.1 26 22.625 25.874999999999996 25.324999999999996 26.174999999999997 27 22.275 26.174999999999997 26.3 25.25 28 22.1 26.424999999999997 27.150000000000002 24.325 29 22.075 27.075 26.224999999999998 24.625 30 23.0 24.175 25.674999999999997 27.150000000000002 31 22.925 25.525 25.624999999999996 25.924999999999997 32 22.525000000000002 26.0 25.924999999999997 25.55 33 21.525 26.35 25.7 26.424999999999997 34 21.55 27.474999999999998 26.525 24.45 35 22.375 26.25 25.75 25.624999999999996 36 22.1 25.6 25.674999999999997 26.625 37 23.150000000000002 25.374999999999996 25.25 26.224999999999998 38 22.675 26.1 25.575 25.650000000000002 39 21.625 26.200000000000003 25.2 26.974999999999998 40 22.25 26.224999999999998 26.05 25.474999999999998 41 22.85 25.85 24.675 26.625 42 23.125 25.874999999999996 24.975 26.025 43 23.7 26.5 24.3 25.5 44 22.95 25.2 26.05 25.8 45 23.075000000000003 24.55 25.2 27.175 46 22.6 25.275 24.125 28.000000000000004 47 22.675 25.424999999999997 25.3 26.6 48 22.20555138784696 24.8062015503876 24.90622655663916 28.08202050512628 49 21.95 25.275 25.25 27.525 50 23.200000000000003 25.124999999999996 24.275 27.400000000000002 51 21.8 25.025 25.650000000000002 27.525 52 23.175 25.25 25.724999999999998 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 2.0 13 1.0 14 0.0 15 0.0 16 1.5 17 3.0 18 4.0 19 5.0 20 5.5 21 6.0 22 9.5 23 13.0 24 12.5 25 12.0 26 16.0 27 20.0 28 25.5 29 31.0 30 36.5 31 42.0 32 59.0 33 76.0 34 86.5 35 97.0 36 116.5 37 136.0 38 158.0 39 201.0 40 222.0 41 243.5 42 265.0 43 271.5 44 278.0 45 295.0 46 312.0 47 313.5 48 315.0 49 302.0 50 289.0 51 299.0 52 309.0 53 316.5 54 324.0 55 283.5 56 243.0 57 222.5 58 202.0 59 188.0 60 174.0 61 162.5 62 151.0 63 120.5 64 74.5 65 59.0 66 57.0 67 55.0 68 40.0 69 25.0 70 21.5 71 18.0 72 16.0 73 14.0 74 10.5 75 7.0 76 7.5 77 8.0 78 8.0 79 8.0 80 5.5 81 3.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.5 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.15587151132175 91.3 2 2.8962611901000526 5.5 3 0.6055818852027383 1.725 4 0.18430753027909424 0.7000000000000001 5 0.13164823591363875 0.625 6 0.02632964718272775 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 6 0.15 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 5 0.125 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra Read 200000 spots for SRR5423334.sra Written 200000 spots for SRR5423334.sra SRR ids: ['SRR5423334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6vaeyph SRR5423334.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423334 file size 703967 SRR5423334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423334 SRR5423334_1.fastq Input file: SRR5423334_1.fastq trimmed: SRR5423334-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:23:28 2025 >> started Wed Feb 12 22:23:30 2025 >> done (1.870s) 4000000 reads processed; of these: 145 ( 0.00%) short reads filtered out after trimming by size control 220 ( 0.01%) empty reads filtered out after trimming by size control 3999635 (99.99%) reads available; of these: 82193 ( 2.06%) trimmed reads available after processing 3917442 (97.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 6 0.00% 25 5 0.00% 26 9 0.00% 27 6 0.00% 28 6 0.00% 29 7 0.00% 30 6 0.00% 31 11 0.00% 32 14 0.00% 33 16 0.00% 34 26 0.00% 35 30 0.00% 36 47 0.00% 37 65 0.00% 38 66 0.00% 39 128 0.00% 40 102 0.00% 41 152 0.00% 42 202 0.01% 43 289 0.01% 44 454 0.01% 45 562 0.01% 46 802 0.02% 47 1135 0.03% 48 1942 0.05% 49 4068 0.10% 50 10437 0.26% 51 61584 1.54% 52 3917442 97.94% 3999635 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=29.93 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTT Started job on | Feb 12 22:23:44 Started mapping on | Feb 12 22:23:44 Finished on | Feb 12 22:23:50 Mapping speed, Million of reads per hour | 2399.78 Number of input reads | 3999635 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292713 Uniquely mapped reads % | 82.33% Average mapped length | 51.78 Number of splices: Total | 320885 Number of splices: Annotated (sjdb) | 316780 Number of splices: GT/AG | 313362 Number of splices: GC/AG | 6107 Number of splices: AT/AC | 490 Number of splices: Non-canonical | 926 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452124 % of reads mapped to multiple loci | 11.30% Number of reads mapped to too many loci | 143736 % of reads mapped to too many loci | 3.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254798 254798 254798 N_multimapping 452124 452124 452124 N_noFeature 607803 3213782 674422 N_ambiguous 25368 211 12856 UnstrandedReadsAssigned:2659542 PositiveStrandReadsAssigned:78720 NegativeStrandReadsAssigned:2605435 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423334 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423334-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,635 reads, 2,943,648 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR5423334.ke.tsv 34699 SRR5423334.se.tsv 87100 total ==> SRR5423334.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 76 13.855 Potri.005G024800.1.v4.1 1035 936 1 0.373758 Potri.004G059700.1.v4.1 961 862 10 4.05844 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 61.5371 7.56962 Potri.016G087400.1.v4.1 270 171 25 51.1458 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 28 11.1566 ==> SRR5423334.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 37 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423334 completed mapping pipeline successfully