Starting /dee2/code/volunteer_pipeline.sh SRR5423335 current disk space = 3050518147072 free memory = 1577917692 SRR5423335 SRAfilesize dd2211be1b2573e6a0a7ce0ebd94efde SRR5423335.sra SRR5423335.sra file validated SRR5423335 is single end SRR5423335 is conventional basespace SRR5423335 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21975 34.0 31.0 34.0 30.0 34.0 2 32.1635 34.0 31.0 34.0 30.0 34.0 3 32.34775 34.0 31.0 34.0 30.0 34.0 4 35.7985 37.0 35.0 37.0 35.0 37.0 5 35.81275 37.0 35.0 37.0 33.0 37.0 6 35.7115 37.0 35.0 37.0 33.0 37.0 7 35.7255 37.0 35.0 37.0 33.0 37.0 8 35.8125 37.0 35.0 37.0 35.0 37.0 9 37.577 39.0 37.0 39.0 35.0 39.0 10 37.203 39.0 37.0 39.0 33.0 39.0 11 37.42075 39.0 37.0 39.0 34.0 39.0 12 37.447 39.0 37.0 39.0 34.0 39.0 13 37.27275 39.0 37.0 39.0 33.0 39.0 14 38.60825 40.0 38.0 41.0 34.0 41.0 15 38.503 40.0 38.0 41.0 33.0 41.0 16 38.70025 40.0 38.0 41.0 34.0 41.0 17 38.56575 40.0 38.0 41.0 34.0 41.0 18 38.64625 40.0 38.0 41.0 34.0 41.0 19 38.72375 40.0 38.0 41.0 34.0 41.0 20 38.611 40.0 38.0 41.0 34.0 41.0 21 38.52975 40.0 38.0 41.0 34.0 41.0 22 38.55175 40.0 38.0 41.0 34.0 41.0 23 38.508 40.0 38.0 41.0 34.0 41.0 24 38.58 40.0 38.0 41.0 34.0 41.0 25 38.43875 40.0 38.0 41.0 34.0 41.0 26 38.42325 40.0 38.0 41.0 34.0 41.0 27 38.304 40.0 38.0 41.0 34.0 41.0 28 38.28625 40.0 38.0 41.0 34.0 41.0 29 38.238 40.0 38.0 41.0 34.0 41.0 30 38.29825 40.0 38.0 41.0 34.0 41.0 31 38.2685 40.0 38.0 41.0 34.0 41.0 32 38.237 40.0 38.0 41.0 34.0 41.0 33 38.0725 40.0 37.0 41.0 33.0 41.0 34 38.05025 40.0 38.0 41.0 33.0 41.0 35 38.015 40.0 38.0 41.0 33.0 41.0 36 37.8395 40.0 37.0 41.0 33.0 41.0 37 37.70075 40.0 37.0 41.0 32.0 41.0 38 37.69825 40.0 37.0 41.0 32.0 41.0 39 37.697 40.0 37.0 41.0 32.0 41.0 40 37.527 40.0 37.0 41.0 32.0 41.0 41 37.5785 40.0 37.0 41.0 32.0 41.0 42 37.5975 40.0 37.0 41.0 33.0 41.0 43 37.52725 40.0 37.0 41.0 32.0 41.0 44 37.40675 39.0 36.0 41.0 31.0 41.0 45 37.26475 40.0 36.0 41.0 31.0 41.0 46 37.09325 39.0 36.0 41.0 31.0 41.0 47 36.92925 39.0 35.0 41.0 30.0 41.0 48 36.89275 39.0 35.0 41.0 30.0 41.0 49 36.9135 39.0 35.0 41.0 31.0 41.0 50 36.889 39.0 35.0 41.0 30.0 41.0 51 36.7355 39.0 35.0 41.0 30.0 41.0 52 36.00175 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2308 1 0.0 2308 2 0.0 2308 3 0.0 2308 4 0.0 2308 5 0.0 2308 6 0.0 2308 7 0.0 2308 8 0.0 2308 9 0.0 2308 10 0.0 2308 11 0.0 2308 12 0.0 2308 13 0.0 2308 14 0.0 2308 15 0.0 2308 16 0.0 2308 17 0.0 2308 18 0.0 2308 19 0.0 2308 20 0.0 2308 21 0.0 2308 22 0.0 2308 23 0.0 2308 24 0.0 2308 25 0.0 2308 26 0.0 2308 27 0.0 2308 28 0.0 2308 29 0.0 2308 30 0.0 2308 31 0.0 2308 32 0.0 2308 33 0.0 2308 34 0.0 2308 35 0.0 2308 36 0.0 2308 37 0.0 2308 38 0.0 2308 39 0.0 2308 40 0.0 2308 41 0.0 2308 42 0.0 2308 43 0.0 2308 44 0.0 2308 45 0.0 2308 46 0.0 2308 47 0.0 2308 48 0.0 2308 49 0.0 2308 50 0.0 2308 51 0.0 2308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 7.0 24 5.0 25 12.0 26 12.0 27 16.0 28 42.0 29 42.0 30 78.0 31 79.0 32 94.0 33 135.0 34 177.0 35 241.0 36 280.0 37 476.0 38 726.0 39 1571.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.58118588941706 9.4070552914686 7.405554165624219 41.60620465349012 2 25.4 13.700000000000001 32.975 27.925 3 24.474999999999998 17.299999999999997 22.6 35.625 4 26.575 26.150000000000002 21.075 26.200000000000003 5 25.575 29.775000000000002 22.900000000000002 21.75 6 20.225 31.825 24.275 23.674999999999997 7 16.35 22.125 41.875 19.650000000000002 8 17.599999999999998 22.25 30.025000000000002 30.125 9 19.35 19.900000000000002 33.25 27.500000000000004 10 18.8 36.375 24.125 20.7 11 23.275000000000002 27.325 21.25 28.15 12 22.375 23.575 26.075 27.975 13 20.65 26.200000000000003 27.750000000000004 25.4 14 20.45 25.5 27.900000000000002 26.150000000000002 15 20.875 27.025 26.224999999999998 25.874999999999996 16 21.425 25.174999999999997 27.675 25.724999999999998 17 21.575 26.650000000000002 26.525 25.25 18 22.075 24.675 26.75 26.5 19 21.4 24.975 26.375 27.250000000000004 20 22.0 25.900000000000002 25.05 27.05 21 21.4 26.575 26.025 26.0 22 21.95 26.400000000000002 25.374999999999996 26.275 23 21.7 27.150000000000002 25.25 25.900000000000002 24 22.1 24.875 26.724999999999998 26.3 25 22.325 25.924999999999997 24.975 26.775 26 22.45 24.575 25.95 27.025 27 22.15 25.174999999999997 26.5 26.174999999999997 28 21.975 25.4 27.35 25.275 29 21.625 25.775 27.625 24.975 30 22.15 23.599999999999998 26.650000000000002 27.6 31 21.675 25.75 25.825 26.75 32 22.75 25.374999999999996 26.6 25.275 33 23.125 25.1 25.775 26.0 34 21.8 25.924999999999997 25.974999999999998 26.3 35 23.0 24.9 25.900000000000002 26.200000000000003 36 24.075 25.724999999999998 23.7 26.5 37 22.05 24.8 25.4 27.750000000000004 38 22.8 25.324999999999996 24.925 26.950000000000003 39 22.95 24.15 25.2 27.700000000000003 40 21.6 25.6 26.450000000000003 26.35 41 22.075 24.775 25.8 27.35 42 23.05 25.275 25.75 25.924999999999997 43 22.525000000000002 27.175 24.325 25.974999999999998 44 20.95 25.624999999999996 26.075 27.35 45 22.85 23.05 26.724999999999998 27.375 46 22.325 26.125 26.05 25.5 47 22.875 25.124999999999996 25.374999999999996 26.625 48 22.575 24.625 26.875 25.924999999999997 49 22.05 25.124999999999996 26.1 26.724999999999998 50 22.375 25.424999999999997 24.925 27.275 51 23.325000000000003 24.175 25.374999999999996 27.125 52 22.650000000000002 26.424999999999997 24.474999999999998 26.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 2.0 19 2.0 20 2.5 21 3.0 22 6.0 23 9.0 24 10.0 25 11.0 26 17.5 27 24.0 28 28.5 29 33.0 30 39.0 31 45.0 32 54.0 33 63.0 34 79.0 35 95.0 36 104.0 37 113.0 38 145.0 39 195.5 40 214.0 41 230.5 42 247.0 43 271.5 44 296.0 45 301.0 46 306.0 47 315.0 48 324.0 49 332.5 50 341.0 51 317.5 52 294.0 53 311.5 54 329.0 55 293.0 56 257.0 57 244.5 58 232.0 59 199.5 60 167.0 61 159.5 62 152.0 63 110.0 64 68.0 65 68.0 66 53.5 67 39.0 68 32.0 69 25.0 70 21.0 71 17.0 72 16.5 73 16.0 74 14.0 75 12.0 76 8.5 77 5.0 78 5.5 79 6.0 80 4.0 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.81746449237244 92.025 2 2.1567596002104157 4.1000000000000005 3 0.4997369805365597 1.425 4 0.23671751709626512 0.8999999999999999 5 0.10520778537611783 0.5 6 0.1841136244082062 1.05 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 6 0.15 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 6 0.15 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 6 0.15 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 6 0.15 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 6 0.15 No Hit GCCGCCGACTCCAACTATCGTCCATGTACGATCCATACTAGATCTGACCAAC 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139353 spots for SRR5423335.sra Written 139353 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra Read 139340 spots for SRR5423335.sra Written 139340 spots for SRR5423335.sra SRR ids: ['SRR5423335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1rbu6xxv SRR5423335.sra spots: 2786813 blocks: [[1, 139340], [139341, 278680], [278681, 418020], [418021, 557360], [557361, 696700], [696701, 836040], [836041, 975380], [975381, 1114720], [1114721, 1254060], [1254061, 1393400], [1393401, 1532740], [1532741, 1672080], [1672081, 1811420], [1811421, 1950760], [1950761, 2090100], [2090101, 2229440], [2229441, 2368780], [2368781, 2508120], [2508121, 2647460], [2647461, 2786813]] SRR5423335 file size 490115 SRR5423335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423335 SRR5423335_1.fastq Input file: SRR5423335_1.fastq trimmed: SRR5423335-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:14:59 2025 >> started Wed Feb 12 22:15:01 2025 >> done (1.819s) 2786813 reads processed; of these: 108 ( 0.00%) short reads filtered out after trimming by size control 142 ( 0.01%) empty reads filtered out after trimming by size control 2786563 (99.99%) reads available; of these: 47283 ( 1.70%) trimmed reads available after processing 2739280 (98.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 3 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 7 0.00% 34 8 0.00% 35 8 0.00% 36 18 0.00% 37 14 0.00% 38 22 0.00% 39 27 0.00% 40 42 0.00% 41 42 0.00% 42 56 0.00% 43 70 0.00% 44 98 0.00% 45 190 0.01% 46 285 0.01% 47 418 0.02% 48 785 0.03% 49 1830 0.07% 50 5445 0.20% 51 37893 1.36% 52 2739280 98.30% 2786563 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=24 prefix-density=0.30 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=27.44 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTT Started job on | Feb 12 22:15:11 Started mapping on | Feb 12 22:15:13 Finished on | Feb 12 22:15:18 Mapping speed, Million of reads per hour | 2006.33 Number of input reads | 2786563 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2292454 Uniquely mapped reads % | 82.27% Average mapped length | 51.78 Number of splices: Total | 222493 Number of splices: Annotated (sjdb) | 219584 Number of splices: GT/AG | 217249 Number of splices: GC/AG | 4234 Number of splices: AT/AC | 360 Number of splices: Non-canonical | 650 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314724 % of reads mapped to multiple loci | 11.29% Number of reads mapped to too many loci | 103347 % of reads mapped to too many loci | 3.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 179385 179385 179385 N_multimapping 314724 314724 314724 N_noFeature 424858 2238217 470559 N_ambiguous 17612 154 8928 UnstrandedReadsAssigned:1849984 PositiveStrandReadsAssigned:54083 NegativeStrandReadsAssigned:1812967 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423335 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423335-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,786,563 reads, 2,064,061 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR5423335.ke.tsv 34699 SRR5423335.se.tsv 87100 total ==> SRR5423335.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 51 13.2685 Potri.005G024800.1.v4.1 1035 936 1 0.533396 Potri.004G059700.1.v4.1 961 862 5 2.89593 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 40.6374 7.13381 Potri.016G087400.1.v4.1 270 171 15 43.7946 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.298243 Potri.012G127500.1.v4.1 977 878 19 10.804 ==> SRR5423335.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 21 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423335 completed mapping pipeline successfully