Starting /dee2/code/volunteer_pipeline.sh SRR5423336 current disk space = 3049661423616 free memory = 1582560880 SRR5423336 SRAfilesize 19d2452f9292d0109e5dc7ccc7fa6256 SRR5423336.sra SRR5423336.sra file validated SRR5423336 is single end SRR5423336 is conventional basespace SRR5423336 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.58225 16.0 16.0 27.0 16.0 30.0 2 22.71225 25.0 16.0 30.0 16.0 30.0 3 24.03675 26.0 16.0 30.0 16.0 31.0 4 28.73575 32.0 19.0 35.0 19.0 35.0 5 22.90075 19.0 19.0 30.0 10.0 35.0 6 22.094 17.0 17.0 30.0 10.0 33.0 7 23.1 25.0 17.0 32.0 10.0 33.0 8 24.13875 27.0 17.0 32.0 11.0 35.0 9 24.14575 27.0 17.0 32.0 10.0 35.0 10 26.20075 28.0 17.0 34.0 15.0 35.0 11 26.7995 30.0 17.0 34.0 15.0 35.0 12 25.8495 27.0 17.0 34.0 11.0 35.0 13 26.0355 27.0 17.0 34.0 11.0 35.0 14 27.05725 30.0 18.0 34.0 11.0 36.0 15 27.964 31.0 25.0 34.0 16.0 37.0 16 27.76175 31.0 23.0 34.0 11.0 37.0 17 27.7145 31.0 24.0 34.0 11.0 37.0 18 24.70325 27.0 17.0 32.0 10.0 36.0 19 26.709 29.0 18.0 34.0 10.0 37.0 20 26.20925 27.0 18.0 34.0 10.0 37.0 21 26.71575 30.0 18.0 34.0 10.0 37.0 22 26.2065 27.0 18.0 34.0 10.0 37.0 23 25.42275 27.0 18.0 34.0 10.0 37.0 24 25.41075 27.0 18.0 34.0 10.0 37.0 25 24.07875 26.0 16.0 32.0 10.0 36.0 26 21.11625 20.0 10.0 30.0 8.0 34.0 27 21.20975 23.0 10.0 30.0 9.0 34.0 28 21.838 24.0 11.0 30.0 9.0 34.0 29 22.92125 25.0 15.0 31.0 9.0 35.0 30 23.3605 25.0 16.0 31.0 9.0 35.0 31 23.43975 25.0 15.0 32.0 9.0 35.0 32 19.21675 16.0 9.0 29.0 8.0 34.0 33 20.21125 19.0 10.0 30.0 8.0 34.0 34 21.5035 24.0 13.0 30.0 8.0 34.0 35 21.069 23.0 10.0 30.0 8.0 34.0 36 20.246 19.0 9.0 30.0 8.0 34.0 37 20.199 19.0 9.0 30.0 8.0 34.0 38 19.5315 16.0 9.0 30.0 8.0 34.0 39 20.31275 21.0 9.0 30.0 8.0 34.0 40 20.0145 20.0 9.0 30.0 8.0 34.0 41 21.03875 23.0 12.0 30.0 8.0 33.0 42 20.84225 23.0 11.0 30.0 8.0 34.0 43 21.0575 23.0 10.0 30.0 8.0 34.0 44 21.4215 23.0 12.0 30.0 8.0 34.0 45 20.78675 22.0 9.0 30.0 8.0 34.0 46 19.722 20.0 9.0 30.0 7.0 33.0 47 19.54775 20.0 9.0 29.0 7.0 33.0 48 20.274 22.0 9.0 30.0 7.0 33.0 49 19.26025 19.0 9.0 28.0 7.0 33.0 50 18.538 17.0 9.0 27.0 7.0 33.0 51 16.86125 14.0 8.0 24.0 7.0 31.0 52 16.71725 14.0 8.0 24.0 7.0 31.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 12 4.0 13 6.0 14 18.0 15 37.0 16 79.0 17 140.0 18 194.0 19 292.0 20 397.0 21 452.0 22 434.0 23 492.0 24 440.0 25 364.0 26 258.0 27 196.0 28 114.0 29 46.0 30 26.0 31 8.0 32 2.0 33 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.36009002250563 14.353588397099276 6.501625406351589 38.78469617404351 2 24.875 15.299999999999999 32.95 26.875 3 23.9 17.75 20.05 38.3 4 26.224999999999998 25.45 19.55 28.775000000000002 5 37.15 24.2 11.0 27.650000000000002 6 21.975 30.575000000000003 23.525 23.925 7 14.649999999999999 20.025000000000002 44.025 21.3 8 20.0 21.2 28.95 29.849999999999998 9 22.225 18.975 32.125 26.674999999999997 10 20.125 31.874999999999996 23.275000000000002 24.725 11 22.5 23.825 22.825 30.85 12 23.925 21.275 26.3 28.499999999999996 13 20.474999999999998 25.874999999999996 28.025 25.624999999999996 14 22.025 21.625 27.900000000000002 28.449999999999996 15 20.625 23.5 27.250000000000004 28.625 16 21.65 23.375 26.724999999999998 28.249999999999996 17 21.075 25.474999999999998 24.349999999999998 29.099999999999998 18 19.5 27.450000000000003 27.224999999999998 25.825 19 22.3 23.65 25.8 28.249999999999996 20 22.55 25.124999999999996 26.400000000000002 25.924999999999997 21 22.95 24.474999999999998 26.950000000000003 25.624999999999996 22 22.875 24.349999999999998 26.474999999999998 26.3 23 21.275 27.35 25.15 26.224999999999998 24 22.5 25.900000000000002 24.075 27.525 25 24.875 25.474999999999998 23.724999999999998 25.924999999999997 26 25.174999999999997 27.35 23.225 24.25 27 23.525 26.125 26.275 24.075 28 23.825 24.8 25.874999999999996 25.5 29 21.099999999999998 28.125 24.474999999999998 26.3 30 23.875 25.424999999999997 22.575 28.125 31 22.175 25.2 26.525 26.1 32 23.0 27.425 22.85 26.724999999999998 33 22.725 28.225 25.1 23.95 34 23.775 22.975 26.5 26.75 35 23.0 25.224999999999998 24.275 27.500000000000004 36 23.275000000000002 26.775 22.85 27.1 37 23.375 26.75 22.85 27.025 38 25.900000000000002 25.924999999999997 22.525000000000002 25.650000000000002 39 22.8 25.174999999999997 25.174999999999997 26.85 40 23.175 25.650000000000002 25.05 26.125 41 21.475 24.7 25.85 27.975 42 22.975 25.35 25.724999999999998 25.95 43 25.224999999999998 23.599999999999998 24.65 26.525 44 25.531382845711427 23.280820205051263 23.80595148787197 27.38184546136534 45 25.85 25.374999999999996 24.099999999999998 24.675 46 24.525 24.375 23.5 27.6 47 23.1807951987997 25.18129532383096 25.331332833208304 26.30657664416104 48 24.406101525381345 26.006501625406354 22.88072018004501 26.70667666916729 49 23.88097024256064 26.60665166291573 22.080520130032507 27.431857964491122 50 23.705926481620406 26.831707926981746 23.830957739434858 25.63140785196299 51 22.975 27.450000000000003 21.875 27.700000000000003 52 25.174999999999997 26.724999999999998 21.0 27.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 3.0 11 2.5 12 2.0 13 2.5 14 1.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.5 21 5.0 22 6.5 23 8.0 24 12.5 25 17.0 26 24.0 27 31.0 28 32.0 29 33.0 30 39.0 31 45.0 32 51.0 33 57.0 34 80.5 35 104.0 36 117.5 37 131.0 38 149.5 39 190.5 40 213.0 41 230.0 42 247.0 43 263.0 44 279.0 45 278.0 46 277.0 47 271.5 48 266.0 49 264.0 50 262.0 51 255.0 52 248.0 53 251.0 54 254.0 55 249.5 56 245.0 57 223.0 58 201.0 59 189.0 60 177.0 61 152.5 62 128.0 63 120.0 64 101.0 65 90.0 66 93.5 67 97.0 68 81.0 69 65.0 70 60.0 71 55.0 72 51.0 73 47.0 74 40.0 75 33.0 76 30.5 77 28.0 78 24.0 79 20.0 80 19.5 81 19.0 82 12.0 83 5.0 84 8.0 85 11.0 86 10.5 87 10.0 88 5.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.0 46 0.0 47 0.025 48 0.025 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88494678155094 97.55 2 0.8869741510390269 1.7500000000000002 3 0.20273694880892043 0.6 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra Read 7634 spots for SRR5423336.sra Written 7634 spots for SRR5423336.sra SRR ids: ['SRR5423336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pv4xggb1 SRR5423336.sra spots: 152680 blocks: [[1, 7634], [7635, 15268], [15269, 22902], [22903, 30536], [30537, 38170], [38171, 45804], [45805, 53438], [53439, 61072], [61073, 68706], [68707, 76340], [76341, 83974], [83975, 91608], [91609, 99242], [99243, 106876], [106877, 114510], [114511, 122144], [122145, 129778], [129779, 137412], [137413, 145046], [145047, 152680]] SRR5423336 file size 26652 SRR5423336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423336 SRR5423336_1.fastq Input file: SRR5423336_1.fastq trimmed: SRR5423336-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 08:30:29 2025 >> started Wed Feb 12 08:30:29 2025 >> done (0.143s) 152680 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 10 ( 0.01%) empty reads filtered out after trimming by size control 152664 (99.99%) reads available; of these: 33167 (21.73%) trimmed reads available after processing 119497 (78.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 33 1 0.00% 34 3 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 3 0.00% 40 5 0.00% 41 5 0.00% 42 15 0.01% 43 14 0.01% 44 31 0.02% 45 43 0.03% 46 137 0.09% 47 302 0.20% 48 742 0.49% 49 1801 1.18% 50 6166 4.04% 51 23898 15.65% 52 119497 78.27% 152664 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.86 fanout-score-rank=8 prefix-density=0.24 prefix-fanout=1.9 sequence=TGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=4.23 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=1.0 sequence=TCTCGTAGTTCTTGGTCTGTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA Started job on | Feb 12 08:30:40 Started mapping on | Feb 12 08:30:40 Finished on | Feb 12 08:30:48 Mapping speed, Million of reads per hour | 68.70 Number of input reads | 152664 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 112326 Uniquely mapped reads % | 73.58% Average mapped length | 51.23 Number of splices: Total | 9384 Number of splices: Annotated (sjdb) | 9228 Number of splices: GT/AG | 9193 Number of splices: GC/AG | 152 Number of splices: AT/AC | 10 Number of splices: Non-canonical | 29 Mismatch rate per base, % | 3.18% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 16526 % of reads mapped to multiple loci | 10.83% Number of reads mapped to too many loci | 4840 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.42% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 23812 23812 23812 N_multimapping 16526 16526 16526 N_noFeature 20329 109808 22410 N_ambiguous 919 7 476 UnstrandedReadsAssigned:91078 PositiveStrandReadsAssigned:2511 NegativeStrandReadsAssigned:89440 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423336 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423336-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 152,664 reads, 66,888 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 978 rounds 52401 SRR5423336.ke.tsv 34699 SRR5423336.se.tsv 87100 total ==> SRR5423336.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 0 0 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 4 71.1471 ==> SRR5423336.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 4 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423336 completed mapping pipeline successfully