Starting /dee2/code/volunteer_pipeline.sh SRR5423337 current disk space = 3050475397120 free memory = 1578917600 SRR5423337 SRAfilesize 6b64d6927ed04e66b9a31c85f946f72d SRR5423337.sra SRR5423337.sra file validated SRR5423337 is single end SRR5423337 is conventional basespace SRR5423337 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.39475 31.0 31.0 34.0 30.0 34.0 2 31.675 31.0 31.0 34.0 30.0 34.0 3 31.77075 31.0 31.0 34.0 30.0 34.0 4 34.3 35.0 35.0 37.0 30.0 37.0 5 34.7205 35.0 35.0 37.0 32.0 37.0 6 35.11925 36.0 35.0 37.0 32.0 37.0 7 35.1575 37.0 35.0 37.0 32.0 37.0 8 35.33325 37.0 35.0 37.0 33.0 37.0 9 36.89225 39.0 37.0 39.0 33.0 39.0 10 36.61875 39.0 35.0 39.0 32.0 39.0 11 36.6535 39.0 35.0 39.0 32.0 39.0 12 36.7035 39.0 35.0 39.0 32.0 39.0 13 36.63625 39.0 35.0 39.0 32.0 39.0 14 37.69775 40.0 37.0 41.0 32.0 41.0 15 37.74875 40.0 37.0 41.0 32.0 41.0 16 37.8785 40.0 37.0 41.0 33.0 41.0 17 37.9805 40.0 37.0 41.0 33.0 41.0 18 37.68775 40.0 37.0 41.0 32.0 41.0 19 37.945 40.0 37.0 41.0 33.0 41.0 20 37.7215 40.0 37.0 41.0 32.0 41.0 21 37.843 40.0 37.0 41.0 32.0 41.0 22 37.81725 40.0 37.0 41.0 32.0 41.0 23 37.247 39.0 36.0 41.0 31.0 41.0 24 37.39575 39.0 36.0 41.0 31.0 41.0 25 37.38275 39.0 36.0 41.0 32.0 41.0 26 37.35325 39.0 36.0 41.0 32.0 41.0 27 37.126 39.0 36.0 41.0 31.0 41.0 28 37.1215 39.0 36.0 41.0 31.0 41.0 29 37.47 39.0 37.0 41.0 32.0 41.0 30 37.0195 39.0 36.0 41.0 30.0 41.0 31 36.91925 39.0 36.0 41.0 30.0 41.0 32 37.071 39.0 36.0 41.0 30.0 41.0 33 37.041 39.0 36.0 41.0 31.0 41.0 34 36.963 39.0 36.0 40.0 30.0 41.0 35 36.97875 39.0 36.0 40.0 30.0 41.0 36 36.92425 39.0 36.0 41.0 30.0 41.0 37 36.83875 39.0 36.0 40.0 30.0 41.0 38 36.79375 39.0 35.0 40.0 30.0 41.0 39 36.8615 39.0 35.0 40.0 30.0 41.0 40 36.69425 39.0 35.0 40.0 30.0 41.0 41 36.51025 39.0 35.0 40.0 30.0 41.0 42 36.43225 39.0 35.0 40.0 30.0 41.0 43 36.405 38.0 35.0 40.0 30.0 41.0 44 36.31975 38.0 35.0 40.0 30.0 41.0 45 36.22575 38.0 35.0 40.0 29.0 41.0 46 36.2395 38.0 35.0 40.0 29.0 41.0 47 36.108 38.0 35.0 40.0 29.0 41.0 48 35.7465 38.0 34.0 40.0 27.0 41.0 49 35.84025 38.0 34.0 40.0 28.0 41.0 50 36.0165 38.0 34.0 40.0 28.0 41.0 51 35.38425 38.0 34.0 40.0 26.0 41.0 52 34.9305 37.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 2.0 22 8.0 23 7.0 24 5.0 25 9.0 26 36.0 27 36.0 28 62.0 29 82.0 30 90.0 31 122.0 32 174.0 33 183.0 34 227.0 35 309.0 36 431.0 37 503.0 38 712.0 39 997.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.71571571571572 9.65965965965966 7.882882882882883 41.74174174174174 2 25.324999999999996 15.55 32.625 26.5 3 23.125 18.55 22.875 35.449999999999996 4 27.675 25.85 18.8 27.675 5 24.0 30.349999999999998 24.15 21.5 6 19.825 32.6 24.275 23.3 7 14.825 23.549999999999997 41.875 19.75 8 17.775 21.625 29.775000000000002 30.825000000000003 9 19.55 20.974999999999998 33.425 26.05 10 18.8 37.45 23.7 20.05 11 24.15 26.35 22.175 27.325 12 23.625 23.3 25.074999999999996 28.000000000000004 13 20.474999999999998 27.224999999999998 26.974999999999998 25.324999999999996 14 20.375 26.950000000000003 26.575 26.1 15 21.925 25.224999999999998 27.35 25.5 16 22.400000000000002 26.325 26.450000000000003 24.825 17 22.35 27.575 24.7 25.374999999999996 18 22.075 25.474999999999998 25.25 27.200000000000003 19 21.65 26.174999999999997 25.525 26.650000000000002 20 21.175 25.374999999999996 27.725 25.724999999999998 21 21.925 26.200000000000003 25.45 26.424999999999997 22 21.45 26.85 26.3 25.4 23 22.25 25.324999999999996 26.275 26.150000000000002 24 22.05 26.150000000000002 24.725 27.075 25 21.575 25.95 25.85 26.625 26 21.475 25.825 27.425 25.275 27 22.325 25.75 25.624999999999996 26.3 28 21.349999999999998 27.375 26.974999999999998 24.3 29 22.625 26.174999999999997 27.450000000000003 23.75 30 21.65 25.874999999999996 25.624999999999996 26.85 31 22.1 25.85 26.35 25.7 32 21.375 27.474999999999998 25.650000000000002 25.5 33 22.075 26.1 25.1 26.724999999999998 34 21.975 25.650000000000002 26.1 26.275 35 21.825 25.45 25.174999999999997 27.55 36 20.325 25.525 26.775 27.375 37 20.974999999999998 26.900000000000002 25.374999999999996 26.75 38 21.975 25.85 25.7 26.474999999999998 39 22.35 24.2 25.624999999999996 27.825 40 21.375 25.75 26.400000000000002 26.474999999999998 41 22.3 24.3 27.700000000000003 25.7 42 21.0 25.75 26.724999999999998 26.525 43 22.55 26.25 24.8 26.400000000000002 44 22.725 25.45 26.05 25.775 45 22.400000000000002 23.45 26.575 27.575 46 21.85 25.2 27.35 25.6 47 23.925 26.0 25.25 24.825 48 23.375 25.45 25.2 25.974999999999998 49 22.075 25.85 24.675 27.400000000000002 50 23.05 25.55 25.074999999999996 26.325 51 21.85 24.7 25.424999999999997 28.025 52 21.425 25.5 27.075 26.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 5.0 21 7.0 22 9.5 23 12.0 24 15.0 25 18.0 26 19.5 27 21.0 28 31.0 29 41.0 30 48.5 31 56.0 32 73.0 33 90.0 34 94.0 35 98.0 36 123.0 37 148.0 38 157.0 39 188.0 40 210.0 41 222.5 42 235.0 43 266.0 44 297.0 45 301.5 46 306.0 47 311.5 48 317.0 49 326.0 50 335.0 51 319.5 52 304.0 53 293.5 54 283.0 55 259.5 56 236.0 57 233.0 58 230.0 59 202.5 60 175.0 61 154.0 62 133.0 63 116.0 64 79.5 65 60.0 66 55.0 67 50.0 68 34.0 69 18.0 70 19.0 71 20.0 72 16.0 73 12.0 74 10.0 75 8.0 76 4.0 77 0.0 78 1.5 79 3.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 1.5 87 2.0 88 1.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 97.01101206082853 92.5 2 1.9664394336654432 3.75 3 0.550603041426324 1.575 4 0.26219192448872575 1.0 5 0.13109596224436287 0.625 6 0.0 0.0 7 0.05243838489774515 0.35000000000000003 8 0.026219192448872573 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 8 0.2 No Hit GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 7 0.17500000000000002 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit CCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra Read 200000 spots for SRR5423337.sra Written 200000 spots for SRR5423337.sra SRR ids: ['SRR5423337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57tsaz7j SRR5423337.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423337 file size 703986 SRR5423337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423337 SRR5423337_1.fastq Input file: SRR5423337_1.fastq trimmed: SRR5423337-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:25:46 2025 >> started Wed Feb 12 22:25:48 2025 >> done (2.035s) 4000000 reads processed; of these: 140 ( 0.00%) short reads filtered out after trimming by size control 224 ( 0.01%) empty reads filtered out after trimming by size control 3999636 (99.99%) reads available; of these: 119757 ( 2.99%) trimmed reads available after processing 3879879 (97.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 6 0.00% 25 10 0.00% 26 10 0.00% 27 12 0.00% 28 23 0.00% 29 19 0.00% 30 18 0.00% 31 23 0.00% 32 32 0.00% 33 46 0.00% 34 69 0.00% 35 67 0.00% 36 78 0.00% 37 97 0.00% 38 100 0.00% 39 163 0.00% 40 194 0.00% 41 231 0.01% 42 319 0.01% 43 393 0.01% 44 619 0.02% 45 806 0.02% 46 1089 0.03% 47 1559 0.04% 48 2779 0.07% 49 5754 0.14% 50 15903 0.40% 51 89316 2.23% 52 3879879 97.01% 3999636 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=28.93 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTTA Started job on | Feb 12 22:25:59 Started mapping on | Feb 12 22:25:59 Finished on | Feb 12 22:26:07 Mapping speed, Million of reads per hour | 1799.84 Number of input reads | 3999636 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3288485 Uniquely mapped reads % | 82.22% Average mapped length | 51.75 Number of splices: Total | 317976 Number of splices: Annotated (sjdb) | 313843 Number of splices: GT/AG | 310468 Number of splices: GC/AG | 6150 Number of splices: AT/AC | 490 Number of splices: Non-canonical | 868 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455661 % of reads mapped to multiple loci | 11.39% Number of reads mapped to too many loci | 139929 % of reads mapped to too many loci | 3.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 255490 255490 255490 N_multimapping 455661 455661 455661 N_noFeature 605165 3210701 670391 N_ambiguous 25598 228 12832 UnstrandedReadsAssigned:2657722 PositiveStrandReadsAssigned:77556 NegativeStrandReadsAssigned:2605262 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423337 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423337-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,636 reads, 2,931,538 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR5423337.ke.tsv 34699 SRR5423337.se.tsv 87100 total ==> SRR5423337.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 74 13.5569 Potri.005G024800.1.v4.1 1035 936 1 0.375601 Potri.004G059700.1.v4.1 961 862 6 2.44707 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 50.4224 6.23298 Potri.016G087400.1.v4.1 270 171 21 43.1743 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 27 10.8111 ==> SRR5423337.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423337 completed mapping pipeline successfully