Starting /dee2/code/volunteer_pipeline.sh SRR5423338 current disk space = 2825126199296 free memory = 1568020024 SRR5423338 SRAfilesize 22d7b50fcfe300d4afd209f2ebb9ff65 SRR5423338.sra SRR5423338.sra file validated SRR5423338 is single end SRR5423338 is conventional basespace SRR5423338 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94675 33.0 31.0 34.0 30.0 34.0 2 31.955 34.0 31.0 34.0 30.0 34.0 3 32.106 34.0 31.0 34.0 30.0 34.0 4 35.4315 37.0 35.0 37.0 33.0 37.0 5 35.5355 37.0 35.0 37.0 33.0 37.0 6 35.561 37.0 35.0 37.0 33.0 37.0 7 35.625 37.0 35.0 37.0 33.0 37.0 8 35.661 37.0 35.0 37.0 33.0 37.0 9 37.37525 39.0 37.0 39.0 34.0 39.0 10 37.2615 39.0 37.0 39.0 34.0 39.0 11 37.34825 39.0 37.0 39.0 34.0 39.0 12 37.32175 39.0 37.0 39.0 34.0 39.0 13 37.255 39.0 37.0 39.0 34.0 39.0 14 38.40575 40.0 38.0 41.0 33.0 41.0 15 38.43625 40.0 38.0 41.0 34.0 41.0 16 38.49225 40.0 38.0 41.0 34.0 41.0 17 38.384 40.0 38.0 41.0 33.0 41.0 18 38.1935 40.0 37.0 41.0 33.0 41.0 19 38.3305 40.0 38.0 41.0 34.0 41.0 20 38.45075 40.0 38.0 41.0 34.0 41.0 21 38.32525 40.0 38.0 41.0 34.0 41.0 22 38.2855 40.0 38.0 41.0 33.0 41.0 23 38.42975 40.0 38.0 41.0 34.0 41.0 24 38.27625 40.0 38.0 41.0 33.0 41.0 25 38.22475 40.0 38.0 41.0 33.0 41.0 26 38.02825 40.0 38.0 41.0 33.0 41.0 27 37.7665 40.0 37.0 41.0 32.0 41.0 28 37.921 40.0 37.0 41.0 33.0 41.0 29 37.77525 40.0 37.0 41.0 32.0 41.0 30 37.90825 40.0 37.0 41.0 33.0 41.0 31 37.76525 40.0 37.0 41.0 33.0 41.0 32 37.697 40.0 37.0 41.0 32.0 41.0 33 37.2865 40.0 36.0 41.0 31.0 41.0 34 37.56575 40.0 37.0 41.0 31.0 41.0 35 37.57 40.0 37.0 41.0 31.0 41.0 36 37.57675 40.0 37.0 41.0 31.0 41.0 37 37.542 40.0 37.0 41.0 31.0 41.0 38 37.37275 40.0 36.0 41.0 31.0 41.0 39 36.9945 39.0 36.0 41.0 30.0 41.0 40 37.10825 40.0 36.0 41.0 30.0 41.0 41 37.2255 40.0 36.0 41.0 31.0 41.0 42 37.2295 39.0 36.0 41.0 31.0 41.0 43 37.09375 39.0 36.0 41.0 31.0 41.0 44 37.00125 39.0 36.0 41.0 30.0 41.0 45 37.17275 39.0 36.0 41.0 31.0 41.0 46 37.11625 39.0 36.0 41.0 31.0 41.0 47 36.7725 39.0 35.0 41.0 30.0 41.0 48 36.66725 39.0 35.0 41.0 30.0 41.0 49 36.7955 39.0 35.0 41.0 30.0 41.0 50 36.69075 39.0 35.0 41.0 30.0 41.0 51 36.71675 39.0 35.0 40.0 30.0 41.0 52 35.31125 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 3.0 22 3.0 23 4.0 24 9.0 25 17.0 26 25.0 27 23.0 28 42.0 29 48.0 30 89.0 31 87.0 32 127.0 33 149.0 34 180.0 35 257.0 36 311.0 37 456.0 38 724.0 39 1438.0 40 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.96137446701781 10.208176573865062 7.123150238274392 40.707298720842736 2 24.775 14.524999999999999 32.7 28.000000000000004 3 23.0 17.95 22.85 36.199999999999996 4 24.075 26.950000000000003 21.4 27.575 5 25.1 31.525 22.95 20.424999999999997 6 19.875 33.050000000000004 23.25 23.825 7 15.325 22.75 40.575 21.349999999999998 8 18.4 21.525 30.75 29.325000000000003 9 18.2 20.05 34.4 27.35 10 19.575 36.25 23.974999999999998 20.200000000000003 11 24.0 28.199999999999996 21.4 26.400000000000002 12 22.175 24.6 26.424999999999997 26.8 13 21.075 26.974999999999998 27.375 24.575 14 20.9 27.250000000000004 27.35 24.5 15 21.525 25.974999999999998 26.6 25.900000000000002 16 21.275 24.85 26.174999999999997 27.700000000000003 17 21.825 25.674999999999997 25.85 26.650000000000002 18 22.6 24.525 26.525 26.35 19 20.95 26.1 26.5 26.450000000000003 20 21.85 25.7 26.05 26.400000000000002 21 21.125 27.275 25.2 26.400000000000002 22 21.2 26.424999999999997 26.325 26.05 23 23.400000000000002 26.474999999999998 25.650000000000002 24.474999999999998 24 22.400000000000002 25.374999999999996 26.075 26.150000000000002 25 20.875 26.525 25.75 26.85 26 22.45 27.0 25.974999999999998 24.575 27 22.725 25.900000000000002 26.6 24.775 28 22.975 25.4 26.55 25.074999999999996 29 23.0 25.025 27.025 24.95 30 22.025 24.45 25.674999999999997 27.85 31 21.9 26.575 25.25 26.275 32 23.599999999999998 26.400000000000002 25.45 24.55 33 21.775 26.05 25.650000000000002 26.525 34 21.275 27.450000000000003 26.325 24.95 35 22.075 25.074999999999996 25.575 27.275 36 21.775 26.25 25.45 26.525 37 22.8 26.200000000000003 24.05 26.950000000000003 38 22.575 25.5 25.1 26.825 39 22.225 24.9 25.525 27.35 40 23.75 25.6 24.575 26.075 41 21.6 27.1 24.275 27.025 42 21.525 24.9 26.0 27.575 43 22.125 25.900000000000002 25.05 26.924999999999997 44 22.025 25.95 26.55 25.474999999999998 45 22.55 24.725 26.3 26.424999999999997 46 22.525000000000002 25.174999999999997 25.85 26.450000000000003 47 24.775 25.3 24.0 25.924999999999997 48 22.650000000000002 25.724999999999998 24.375 27.250000000000004 49 22.875 25.85 23.974999999999998 27.3 50 23.025000000000002 25.900000000000002 24.9 26.174999999999997 51 22.15 25.0 24.45 28.4 52 22.2 26.200000000000003 24.675 26.924999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 3.0 20 2.5 21 2.0 22 4.5 23 7.0 24 13.5 25 20.0 26 19.5 27 19.0 28 24.5 29 30.0 30 39.0 31 48.0 32 60.0 33 72.0 34 86.5 35 101.0 36 111.5 37 122.0 38 143.5 39 194.0 40 223.0 41 246.5 42 270.0 43 282.5 44 295.0 45 305.5 46 316.0 47 325.0 48 334.0 49 324.5 50 315.0 51 312.5 52 310.0 53 316.0 54 322.0 55 277.0 56 232.0 57 225.0 58 218.0 59 188.5 60 159.0 61 148.5 62 138.0 63 109.5 64 76.0 65 71.0 66 57.0 67 43.0 68 33.0 69 23.0 70 20.5 71 18.0 72 18.5 73 19.0 74 11.0 75 3.0 76 4.0 77 5.0 78 4.5 79 4.0 80 4.0 81 4.0 82 2.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.48520084566596 91.27499999999999 2 2.3784355179704018 4.5 3 0.6342494714587738 1.7999999999999998 4 0.18498942917547567 0.7000000000000001 5 0.18498942917547567 0.8750000000000001 6 0.052854122621564484 0.3 7 0.052854122621564484 0.35000000000000003 8 0.026427061310782242 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 8 0.2 No Hit GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 7 0.17500000000000002 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 7 0.17500000000000002 No Hit GGCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGA 6 0.15 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra Read 200000 spots for SRR5423338.sra Written 200000 spots for SRR5423338.sra SRR ids: ['SRR5423338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_svj9m_z8 SRR5423338.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423338 file size 703977 SRR5423338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423338 SRR5423338_1.fastq Input file: SRR5423338_1.fastq trimmed: SRR5423338-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 11:23:37 2025 >> started Thu Apr 10 11:23:39 2025 >> done (1.816s) 4000000 reads processed; of these: 159 ( 0.00%) short reads filtered out after trimming by size control 197 ( 0.00%) empty reads filtered out after trimming by size control 3999644 (99.99%) reads available; of these: 108889 ( 2.72%) trimmed reads available after processing 3890755 (97.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 6 0.00% 25 16 0.00% 26 8 0.00% 27 11 0.00% 28 11 0.00% 29 13 0.00% 30 24 0.00% 31 15 0.00% 32 32 0.00% 33 29 0.00% 34 43 0.00% 35 57 0.00% 36 79 0.00% 37 73 0.00% 38 94 0.00% 39 137 0.00% 40 162 0.00% 41 188 0.00% 42 237 0.01% 43 331 0.01% 44 536 0.01% 45 702 0.02% 46 846 0.02% 47 1315 0.03% 48 2346 0.06% 49 5129 0.13% 50 13548 0.34% 51 82890 2.07% 52 3890755 97.28% 3999644 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.37 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.5 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Apr 10 11:24:01 Started mapping on | Apr 10 11:24:01 Finished on | Apr 10 11:24:06 Mapping speed, Million of reads per hour | 2879.74 Number of input reads | 3999644 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292242 Uniquely mapped reads % | 82.31% Average mapped length | 51.77 Number of splices: Total | 320387 Number of splices: Annotated (sjdb) | 316155 Number of splices: GT/AG | 312689 Number of splices: GC/AG | 6259 Number of splices: AT/AC | 505 Number of splices: Non-canonical | 934 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453932 % of reads mapped to multiple loci | 11.35% Number of reads mapped to too many loci | 142319 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253470 253470 253470 N_multimapping 453932 453932 453932 N_noFeature 604556 3214571 669967 N_ambiguous 25530 232 13053 UnstrandedReadsAssigned:2662156 PositiveStrandReadsAssigned:77439 NegativeStrandReadsAssigned:2609222 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423338 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423338-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,644 reads, 2,961,976 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR5423338.ke.tsv 34699 SRR5423338.se.tsv 87100 total ==> SRR5423338.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 111 20.1346 Potri.005G024800.1.v4.1 1035 936 1 0.371893 Potri.004G059700.1.v4.1 961 862 7 2.82673 Potri.007G009000.2.v4.1 1416 1317 1 0.264307 Potri.003G141000.2.v4.1 2943 2844 64.336 7.87442 Potri.016G087400.1.v4.1 270 171 23 46.8194 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 32 12.6867 ==> SRR5423338.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 40 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423338 completed mapping pipeline successfully