Starting /dee2/code/volunteer_pipeline.sh SRR5423339 current disk space = 3050477318144 free memory = 1579176972 SRR5423339 SRAfilesize 0ac5c8a45fff6520a0295bd4ea80507b SRR5423339.sra SRR5423339.sra file validated SRR5423339 is single end SRR5423339 is conventional basespace SRR5423339 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.245 34.0 31.0 34.0 30.0 34.0 2 32.292 34.0 31.0 34.0 30.0 34.0 3 32.26425 34.0 31.0 34.0 30.0 34.0 4 35.7845 37.0 35.0 37.0 35.0 37.0 5 35.79125 37.0 35.0 37.0 33.0 37.0 6 35.519 37.0 35.0 37.0 33.0 37.0 7 35.76425 37.0 35.0 37.0 35.0 37.0 8 35.78975 37.0 35.0 37.0 35.0 37.0 9 37.54075 39.0 37.0 39.0 35.0 39.0 10 37.38675 39.0 37.0 39.0 34.0 39.0 11 37.4305 39.0 37.0 39.0 34.0 39.0 12 37.47075 39.0 37.0 39.0 34.0 39.0 13 37.4215 39.0 37.0 39.0 34.0 39.0 14 38.784 40.0 38.0 41.0 35.0 41.0 15 38.7315 40.0 38.0 41.0 34.0 41.0 16 38.70275 40.0 38.0 41.0 34.0 41.0 17 38.54775 40.0 38.0 41.0 33.0 41.0 18 38.46725 40.0 38.0 41.0 33.0 41.0 19 38.685 40.0 38.0 41.0 34.0 41.0 20 38.59975 40.0 38.0 41.0 34.0 41.0 21 38.48025 40.0 38.0 41.0 34.0 41.0 22 38.503 40.0 38.0 41.0 34.0 41.0 23 38.5335 40.0 38.0 41.0 34.0 41.0 24 38.51 40.0 38.0 41.0 34.0 41.0 25 38.45 40.0 38.0 41.0 34.0 41.0 26 38.37225 40.0 38.0 41.0 34.0 41.0 27 38.32625 40.0 38.0 41.0 33.0 41.0 28 38.26275 40.0 38.0 41.0 33.0 41.0 29 38.09775 40.0 38.0 41.0 33.0 41.0 30 38.048 40.0 38.0 41.0 33.0 41.0 31 37.89725 40.0 37.0 41.0 32.0 41.0 32 37.97025 40.0 38.0 41.0 33.0 41.0 33 37.962 40.0 37.0 41.0 33.0 41.0 34 37.76325 40.0 37.0 41.0 32.0 41.0 35 37.77925 40.0 37.0 41.0 32.0 41.0 36 37.83275 40.0 37.0 41.0 32.0 41.0 37 37.555 40.0 37.0 41.0 32.0 41.0 38 37.32475 40.0 36.0 41.0 31.0 41.0 39 37.3835 40.0 37.0 41.0 31.0 41.0 40 37.43 40.0 37.0 41.0 31.0 41.0 41 37.475 40.0 37.0 41.0 31.0 41.0 42 37.4845 40.0 37.0 41.0 31.0 41.0 43 37.36525 40.0 37.0 41.0 31.0 41.0 44 37.184 40.0 36.0 41.0 31.0 41.0 45 36.927 39.0 36.0 41.0 30.0 41.0 46 36.95525 39.0 36.0 41.0 30.0 41.0 47 36.913 39.0 35.0 41.0 30.0 41.0 48 36.4605 39.0 35.0 41.0 29.0 41.0 49 36.5605 39.0 35.0 41.0 29.0 41.0 50 36.62525 39.0 35.0 41.0 30.0 41.0 51 36.62725 39.0 35.0 41.0 29.0 41.0 52 35.20525 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1306 1 0.0 1306 2 0.0 1306 3 0.0 1306 4 0.0 1306 5 0.0 1306 6 0.0 1306 7 0.0 1306 8 0.0 1306 9 0.0 1306 10 0.0 1306 11 0.0 1306 12 0.0 1306 13 0.0 1306 14 0.0 1306 15 0.0 1306 16 0.0 1306 17 0.0 1306 18 0.0 1306 19 0.0 1306 20 0.0 1306 21 0.0 1306 22 0.0 1306 23 0.0 1306 24 0.0 1306 25 0.0 1306 26 0.0 1306 27 0.0 1306 28 0.0 1306 29 0.0 1306 30 0.0 1306 31 0.0 1306 32 0.0 1306 33 0.0 1306 34 0.0 1306 35 0.0 1306 36 0.0 1306 37 0.0 1306 38 0.0 1306 39 0.0 1306 40 0.0 1306 41 0.0 1306 42 0.0 1306 43 0.0 1306 44 0.0 1306 45 0.0 1306 46 0.0 1306 47 0.0 1306 48 0.0 1306 49 0.0 1306 50 0.0 1306 51 0.0 1306 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 1.0 21 2.0 22 4.0 23 4.0 24 7.0 25 12.0 26 21.0 27 27.0 28 47.0 29 52.0 30 66.0 31 87.0 32 113.0 33 118.0 34 172.0 35 231.0 36 296.0 37 450.0 38 700.0 39 1580.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.36034008502126 9.877469367341837 7.351837959489872 41.410352588147035 2 23.474999999999998 14.35 34.375 27.800000000000004 3 22.5 17.375 24.224999999999998 35.9 4 28.1 24.224999999999998 19.775000000000002 27.900000000000002 5 25.8 29.599999999999998 23.45 21.15 6 19.225 31.85 25.4 23.525 7 15.475 21.95 43.375 19.2 8 17.549999999999997 20.95 30.325000000000003 31.175000000000004 9 18.925 21.8 33.125 26.150000000000002 10 19.3 36.8 23.375 20.525 11 22.6 28.849999999999998 21.725 26.825 12 23.9 22.45 26.05 27.6 13 19.400000000000002 27.400000000000002 27.375 25.825 14 20.575 25.7 28.875 24.85 15 22.400000000000002 25.5 25.874999999999996 26.224999999999998 16 22.225 25.650000000000002 26.450000000000003 25.674999999999997 17 22.35 25.1 26.400000000000002 26.150000000000002 18 22.0 25.75 25.874999999999996 26.375 19 22.1 26.6 25.825 25.474999999999998 20 20.674999999999997 26.325 26.8 26.200000000000003 21 22.5 25.074999999999996 25.75 26.674999999999997 22 21.775 27.325 25.4 25.5 23 21.75 26.224999999999998 25.674999999999997 26.35 24 21.175 25.424999999999997 26.400000000000002 27.0 25 21.95 25.6 26.674999999999997 25.775 26 23.150000000000002 25.6 25.7 25.55 27 21.325 26.85 25.45 26.375 28 22.825 25.35 26.875 24.95 29 22.375 25.85 25.8 25.974999999999998 30 21.4 24.4 27.05 27.150000000000002 31 22.15 26.35 25.900000000000002 25.6 32 21.075 25.85 26.825 26.25 33 22.325 24.275 26.35 27.05 34 21.8 27.025 25.8 25.374999999999996 35 21.125 25.8 26.224999999999998 26.85 36 21.0 26.325 26.075 26.6 37 21.4 25.900000000000002 26.1 26.6 38 23.0 25.775 25.85 25.374999999999996 39 24.0 23.775 24.625 27.6 40 22.425 26.35 25.1 26.125 41 21.875 26.174999999999997 25.374999999999996 26.575 42 22.975 24.2 26.724999999999998 26.1 43 22.6 25.55 24.875 26.974999999999998 44 21.675 25.525 26.474999999999998 26.325 45 23.7 24.75 24.375 27.175 46 23.025000000000002 24.65 26.3 26.025 47 24.93123280820205 25.156289072268066 24.831207801950487 25.081270317579396 48 22.7 25.124999999999996 26.275 25.900000000000002 49 21.85 25.650000000000002 26.474999999999998 26.025 50 23.25 24.775 25.650000000000002 26.325 51 22.6 24.275 25.1 28.025 52 22.85 25.05 25.05 27.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 3.0 18 4.5 19 6.0 20 5.0 21 4.0 22 5.5 23 7.0 24 12.5 25 18.0 26 18.5 27 19.0 28 27.5 29 36.0 30 37.0 31 38.0 32 56.5 33 75.0 34 83.0 35 91.0 36 113.0 37 135.0 38 163.5 39 203.0 40 214.0 41 229.0 42 244.0 43 274.0 44 304.0 45 304.0 46 304.0 47 296.5 48 289.0 49 314.5 50 340.0 51 335.0 52 330.0 53 315.5 54 301.0 55 283.5 56 266.0 57 245.0 58 224.0 59 192.5 60 161.0 61 141.5 62 122.0 63 107.0 64 75.5 65 59.0 66 50.5 67 42.0 68 37.5 69 33.0 70 27.0 71 21.0 72 13.0 73 5.0 74 7.0 75 9.0 76 6.0 77 3.0 78 5.5 79 8.0 80 5.0 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.20772442588726 93.125 2 1.9050104384133613 3.65 3 0.44363256784968685 1.275 4 0.2609603340292276 1.0 5 0.1304801670146138 0.625 6 0.026096033402922752 0.15 7 0.026096033402922752 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 6 0.15 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAG 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra Read 200000 spots for SRR5423339.sra Written 200000 spots for SRR5423339.sra SRR ids: ['SRR5423339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8jinheo SRR5423339.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423339 file size 703931 SRR5423339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423339 SRR5423339_1.fastq Input file: SRR5423339_1.fastq trimmed: SRR5423339-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:34:10 2025 >> started Wed Feb 12 22:34:13 2025 >> done (2.792s) 4000000 reads processed; of these: 121 ( 0.00%) short reads filtered out after trimming by size control 188 ( 0.00%) empty reads filtered out after trimming by size control 3999691 (99.99%) reads available; of these: 99548 ( 2.49%) trimmed reads available after processing 3900143 (97.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 7 0.00% 26 5 0.00% 27 3 0.00% 28 4 0.00% 29 8 0.00% 30 13 0.00% 31 13 0.00% 32 17 0.00% 33 27 0.00% 34 38 0.00% 35 36 0.00% 36 80 0.00% 37 60 0.00% 38 70 0.00% 39 118 0.00% 40 134 0.00% 41 145 0.00% 42 199 0.00% 43 234 0.01% 44 353 0.01% 45 451 0.01% 46 701 0.02% 47 1135 0.03% 48 1996 0.05% 49 4575 0.11% 50 12135 0.30% 51 76974 1.92% 52 3900143 97.51% 3999691 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=22.46 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 22:34:26 Started mapping on | Feb 12 22:34:26 Finished on | Feb 12 22:34:32 Mapping speed, Million of reads per hour | 2399.81 Number of input reads | 3999691 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3291805 Uniquely mapped reads % | 82.30% Average mapped length | 51.77 Number of splices: Total | 320786 Number of splices: Annotated (sjdb) | 316510 Number of splices: GT/AG | 313162 Number of splices: GC/AG | 6205 Number of splices: AT/AC | 508 Number of splices: Non-canonical | 911 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453790 % of reads mapped to multiple loci | 11.35% Number of reads mapped to too many loci | 144544 % of reads mapped to too many loci | 3.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254096 254096 254096 N_multimapping 453790 453790 453790 N_noFeature 606307 3214203 671577 N_ambiguous 25440 209 12914 UnstrandedReadsAssigned:2660058 PositiveStrandReadsAssigned:77393 NegativeStrandReadsAssigned:2607314 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423339 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423339-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,691 reads, 2,960,868 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR5423339.ke.tsv 34699 SRR5423339.se.tsv 87100 total ==> SRR5423339.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 90 16.337 Potri.005G024800.1.v4.1 1035 936 1 0.37216 Potri.004G059700.1.v4.1 961 862 7 2.82876 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 66.5534 8.15165 Potri.016G087400.1.v4.1 270 171 27 55.0013 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 21 8.33163 ==> SRR5423339.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423339 completed mapping pipeline successfully