Starting /dee2/code/volunteer_pipeline.sh SRR5423340 current disk space = 3050648100864 free memory = 1469318672 SRR5423340 SRAfilesize 8e52b68a29e7da6f2fcbdd6c83e1bda9 SRR5423340.sra SRR5423340.sra file validated SRR5423340 is single end SRR5423340 is conventional basespace SRR5423340 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.268 34.0 31.0 34.0 30.0 34.0 2 32.48425 34.0 31.0 34.0 30.0 34.0 3 32.53425 34.0 31.0 34.0 30.0 34.0 4 36.059 37.0 35.0 37.0 35.0 37.0 5 35.96 37.0 35.0 37.0 35.0 37.0 6 35.95875 37.0 35.0 37.0 35.0 37.0 7 35.916 37.0 35.0 37.0 35.0 37.0 8 35.85875 37.0 35.0 37.0 35.0 37.0 9 37.57775 39.0 37.0 39.0 35.0 39.0 10 37.4625 39.0 37.0 39.0 35.0 39.0 11 37.50225 39.0 37.0 39.0 35.0 39.0 12 37.49 39.0 37.0 39.0 35.0 39.0 13 37.5695 39.0 37.0 39.0 35.0 39.0 14 39.01425 40.0 38.0 41.0 36.0 41.0 15 38.93 40.0 38.0 41.0 35.0 41.0 16 38.84625 40.0 38.0 41.0 35.0 41.0 17 38.89825 40.0 38.0 41.0 35.0 41.0 18 38.84075 40.0 38.0 41.0 35.0 41.0 19 38.83125 40.0 38.0 41.0 35.0 41.0 20 38.85975 40.0 38.0 41.0 35.0 41.0 21 38.737 40.0 38.0 41.0 34.0 41.0 22 38.6545 40.0 38.0 41.0 34.0 41.0 23 38.709 40.0 38.0 41.0 35.0 41.0 24 38.53025 40.0 38.0 41.0 34.0 41.0 25 38.427 40.0 38.0 41.0 34.0 41.0 26 38.32 40.0 38.0 41.0 34.0 41.0 27 38.31975 40.0 38.0 41.0 34.0 41.0 28 38.17475 40.0 38.0 41.0 33.0 41.0 29 38.09725 40.0 38.0 41.0 33.0 41.0 30 38.02375 40.0 38.0 41.0 33.0 41.0 31 37.91075 40.0 38.0 41.0 33.0 41.0 32 38.01075 40.0 38.0 41.0 33.0 41.0 33 37.65325 40.0 37.0 41.0 31.0 41.0 34 37.5945 40.0 37.0 41.0 32.0 41.0 35 37.4755 40.0 37.0 41.0 31.0 41.0 36 37.54975 40.0 37.0 41.0 31.0 41.0 37 37.5615 40.0 37.0 41.0 32.0 41.0 38 37.458 40.0 37.0 41.0 31.0 41.0 39 37.3905 40.0 37.0 41.0 31.0 41.0 40 37.4425 40.0 37.0 41.0 31.0 41.0 41 37.34 40.0 37.0 41.0 31.0 41.0 42 37.131 40.0 37.0 41.0 30.0 41.0 43 36.91075 40.0 36.0 41.0 30.0 41.0 44 14.1845 9.0 8.0 15.0 7.0 35.0 45 22.49275 23.0 15.0 29.0 13.0 37.0 46 30.238 33.0 28.0 35.0 20.0 38.0 47 33.82125 37.0 32.0 38.0 25.0 39.0 48 35.2475 38.0 34.0 39.0 27.0 40.0 49 35.962 39.0 35.0 40.0 29.0 41.0 50 36.22025 39.0 35.0 40.0 28.0 41.0 51 36.30525 39.0 35.0 40.0 28.0 41.0 52 33.84425 37.0 32.0 40.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2102 1 0.0 2102 2 0.0 2102 3 0.0 2102 4 0.0 2102 5 0.0 2102 6 0.0 2102 7 0.0 2102 8 0.0 2102 9 0.0 2102 10 0.0 2102 11 0.0 2102 12 0.0 2102 13 0.0 2102 14 0.0 2102 15 0.0 2102 16 0.0 2102 17 0.0 2102 18 0.0 2102 19 0.0 2102 20 0.0 2102 21 0.0 2102 22 0.0 2102 23 0.0 2102 24 0.0 2102 25 0.0 2102 26 0.0 2102 27 0.0 2102 28 0.0 2102 29 0.0 2102 30 0.0 2102 31 0.0 2102 32 0.0 2102 33 0.0 2102 34 0.0 2102 35 0.0 2102 36 0.0 2102 37 0.0 2102 38 0.0 2102 39 0.0 2102 40 0.0 2102 41 0.0 2102 42 0.0 2102 43 0.0 2102 44 0.0 2102 45 0.0 2102 46 0.0 2102 47 0.0 2102 48 0.0 2102 49 0.0 2102 50 0.0 2102 51 0.0 2102 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 2.0 20 2.0 21 6.0 22 8.0 23 7.0 24 16.0 25 26.0 26 26.0 27 33.0 28 46.0 29 52.0 30 76.0 31 89.0 32 106.0 33 199.0 34 221.0 35 302.0 36 446.0 37 798.0 38 1309.0 39 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.66942148760331 10.743801652892563 7.9388930628600045 41.64788379664412 2 23.95 13.65 34.525 27.875 3 23.200000000000003 16.35 23.65 36.8 4 26.55 26.6 19.375 27.474999999999998 5 25.15 31.225 23.375 20.25 6 19.475 33.2 22.75 24.575 7 15.425 22.325 42.0 20.25 8 18.55 22.275 31.075000000000003 28.1 9 19.725 21.5 33.775 25.0 10 20.599999999999998 35.625 23.275000000000002 20.5 11 24.85 26.05 21.45 27.650000000000002 12 22.8 23.125 25.124999999999996 28.95 13 20.4 26.075 27.200000000000003 26.325 14 21.475 27.525 25.85 25.15 15 21.3 25.874999999999996 27.625 25.2 16 21.525 26.674999999999997 26.200000000000003 25.6 17 22.125 24.925 27.35 25.6 18 21.9 25.900000000000002 26.6 25.6 19 22.7 26.5 25.074999999999996 25.724999999999998 20 22.225 25.174999999999997 26.6 26.0 21 21.325 24.7 26.775 27.200000000000003 22 21.825 26.1 26.400000000000002 25.674999999999997 23 21.9 25.0 26.325 26.775 24 21.224999999999998 27.375 25.4 26.0 25 22.5 26.8 24.45 26.25 26 23.075000000000003 26.25 24.725 25.95 27 23.549999999999997 24.275 25.924999999999997 26.25 28 22.675 25.650000000000002 26.525 25.15 29 23.425 25.35 27.400000000000002 23.825 30 22.55 25.15 25.900000000000002 26.400000000000002 31 22.175 25.4 25.95 26.474999999999998 32 22.475 26.1 25.124999999999996 26.3 33 21.725 26.1 25.674999999999997 26.5 34 21.475 26.174999999999997 25.575 26.775 35 22.7 25.2 25.7 26.400000000000002 36 22.7 25.624999999999996 24.5 27.175 37 21.75 25.674999999999997 26.075 26.5 38 23.125 25.025 25.074999999999996 26.775 39 21.375 24.65 26.400000000000002 27.575 40 21.275 25.424999999999997 26.474999999999998 26.825 41 22.5 26.200000000000003 25.674999999999997 25.624999999999996 42 22.25 25.474999999999998 25.624999999999996 26.650000000000002 43 23.225 24.45 25.724999999999998 26.6 44 29.799999999999997 38.775 13.200000000000001 18.224999999999998 45 23.425 23.849999999999998 25.7 27.025 46 22.975 25.35 25.4 26.275 47 23.200000000000003 26.5 24.8 25.5 48 22.375 26.174999999999997 24.725 26.724999999999998 49 23.150000000000002 25.924999999999997 24.625 26.3 50 24.075 25.8 25.474999999999998 24.65 51 22.3 25.1 24.575 28.025 52 23.200000000000003 25.724999999999998 23.9 27.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 4.5 21 5.0 22 5.0 23 5.0 24 7.0 25 9.0 26 16.5 27 24.0 28 28.5 29 33.0 30 41.0 31 49.0 32 59.0 33 69.0 34 79.5 35 90.0 36 110.0 37 130.0 38 160.5 39 192.5 40 194.0 41 235.5 42 277.0 43 275.0 44 273.0 45 285.0 46 297.0 47 307.5 48 318.0 49 306.5 50 295.0 51 318.5 52 342.0 53 335.5 54 329.0 55 307.5 56 286.0 57 244.5 58 203.0 59 187.0 60 171.0 61 151.5 62 132.0 63 116.0 64 80.0 65 60.0 66 51.0 67 42.0 68 32.0 69 22.0 70 18.5 71 15.0 72 12.0 73 9.0 74 8.5 75 8.0 76 5.5 77 3.0 78 4.0 79 5.0 80 4.0 81 3.0 82 2.0 83 1.0 84 2.0 85 3.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49412965798876 96.475 2 1.1485451761102603 2.25 3 0.17866258295048493 0.525 4 0.1276161306789178 0.5 5 0.05104645227156713 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra Read 200000 spots for SRR5423340.sra Written 200000 spots for SRR5423340.sra SRR ids: ['SRR5423340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1bfdf6ve SRR5423340.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423340 file size 703990 SRR5423340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423340 SRR5423340_1.fastq Input file: SRR5423340_1.fastq trimmed: SRR5423340-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:00:39 2025 >> started Wed Feb 12 22:00:41 2025 >> done (1.640s) 4000000 reads processed; of these: 128 ( 0.00%) short reads filtered out after trimming by size control 167 ( 0.00%) empty reads filtered out after trimming by size control 3999705 (99.99%) reads available; of these: 115450 ( 2.89%) trimmed reads available after processing 3884255 (97.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 8 0.00% 25 5 0.00% 26 12 0.00% 27 15 0.00% 28 8 0.00% 29 16 0.00% 30 13 0.00% 31 24 0.00% 32 28 0.00% 33 39 0.00% 34 52 0.00% 35 62 0.00% 36 67 0.00% 37 96 0.00% 38 92 0.00% 39 149 0.00% 40 170 0.00% 41 203 0.01% 42 270 0.01% 43 370 0.01% 44 591 0.01% 45 782 0.02% 46 949 0.02% 47 1415 0.04% 48 2523 0.06% 49 5333 0.13% 50 14089 0.35% 51 88056 2.20% 52 3884255 97.11% 3999705 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=31.16 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTTA Started job on | Feb 12 22:00:55 Started mapping on | Feb 12 22:00:55 Finished on | Feb 12 22:01:02 Mapping speed, Million of reads per hour | 2056.99 Number of input reads | 3999705 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3291914 Uniquely mapped reads % | 82.30% Average mapped length | 51.76 Number of splices: Total | 320023 Number of splices: Annotated (sjdb) | 315896 Number of splices: GT/AG | 312637 Number of splices: GC/AG | 6013 Number of splices: AT/AC | 521 Number of splices: Non-canonical | 852 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455859 % of reads mapped to multiple loci | 11.40% Number of reads mapped to too many loci | 139671 % of reads mapped to too many loci | 3.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 251932 251932 251932 N_multimapping 455859 455859 455859 N_noFeature 607094 3214155 672554 N_ambiguous 25502 240 12989 UnstrandedReadsAssigned:2659318 PositiveStrandReadsAssigned:77519 NegativeStrandReadsAssigned:2606371 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423340 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423340-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,705 reads, 2,953,393 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR5423340.ke.tsv 34699 SRR5423340.se.tsv 87100 total ==> SRR5423340.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 67 12.1825 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 13 5.26228 Potri.007G009000.2.v4.1 1416 1317 1 0.264943 Potri.003G141000.2.v4.1 2943 2844 61.5169 7.54749 Potri.016G087400.1.v4.1 270 171 23 46.932 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.208441 Potri.012G127500.1.v4.1 977 878 26 10.3328 ==> SRR5423340.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423340 completed mapping pipeline successfully