Starting /dee2/code/volunteer_pipeline.sh SRR5423341 current disk space = 3050456305664 free memory = 1579673664 SRR5423341 SRAfilesize be895bb26a08b03efa6f1cbcd40d7a68 SRR5423341.sra SRR5423341.sra file validated SRR5423341 is single end SRR5423341 is conventional basespace SRR5423341 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5705 31.0 30.0 33.0 27.0 34.0 2 30.96425 31.0 30.0 34.0 27.0 34.0 3 31.0975 31.0 31.0 34.0 27.0 34.0 4 31.1085 35.0 28.0 37.0 19.0 37.0 5 33.62675 35.0 33.0 37.0 28.0 37.0 6 33.95225 35.0 33.0 37.0 30.0 37.0 7 34.3165 35.0 35.0 37.0 30.0 37.0 8 34.70525 35.0 35.0 37.0 32.0 37.0 9 36.3705 38.0 35.0 39.0 32.0 39.0 10 36.25725 38.0 35.0 39.0 32.0 39.0 11 36.27025 38.0 35.0 39.0 32.0 39.0 12 36.27625 38.0 35.0 39.0 32.0 39.0 13 35.878 37.0 35.0 39.0 30.0 39.0 14 37.45 39.0 36.0 40.0 32.0 41.0 15 37.21325 39.0 36.0 40.0 31.0 41.0 16 37.03975 39.0 36.0 40.0 31.0 41.0 17 36.814 38.0 36.0 40.0 31.0 41.0 18 37.01075 39.0 36.0 40.0 31.0 41.0 19 36.72475 39.0 36.0 40.0 30.0 41.0 20 37.2575 39.0 36.0 40.0 31.0 41.0 21 37.10675 39.0 36.0 40.0 31.0 41.0 22 37.22925 39.0 36.0 40.0 31.0 41.0 23 37.416 39.0 36.0 40.0 32.0 41.0 24 37.1665 39.0 36.0 40.0 32.0 41.0 25 36.93 39.0 36.0 40.0 31.0 41.0 26 37.31575 39.0 36.0 40.0 32.0 41.0 27 37.13925 39.0 36.0 40.0 31.0 41.0 28 36.61325 39.0 36.0 40.0 30.0 41.0 29 36.595 39.0 35.0 40.0 30.0 41.0 30 36.56275 39.0 35.0 40.0 30.0 41.0 31 36.639 39.0 35.0 40.0 30.0 41.0 32 36.728 39.0 36.0 40.0 30.0 41.0 33 36.10375 38.0 35.0 40.0 29.0 41.0 34 36.40125 38.0 35.0 40.0 30.0 41.0 35 36.2395 38.0 35.0 40.0 29.0 41.0 36 35.9925 38.0 35.0 40.0 29.0 41.0 37 36.42275 38.0 35.0 40.0 30.0 41.0 38 36.2995 38.0 35.0 40.0 30.0 41.0 39 36.123 38.0 35.0 40.0 30.0 41.0 40 36.2375 38.0 35.0 40.0 30.0 41.0 41 35.838 38.0 34.0 40.0 28.0 41.0 42 35.33375 38.0 33.0 40.0 27.0 41.0 43 36.02375 38.0 35.0 40.0 29.0 41.0 44 35.9205 38.0 34.0 40.0 29.0 41.0 45 36.013 38.0 35.0 40.0 29.0 41.0 46 35.735 38.0 34.0 40.0 27.0 41.0 47 35.43 38.0 33.0 40.0 27.0 41.0 48 35.742 38.0 34.0 40.0 28.0 41.0 49 35.45125 38.0 33.0 40.0 27.0 41.0 50 35.27275 38.0 33.0 40.0 27.0 41.0 51 35.50875 38.0 34.0 40.0 28.0 41.0 52 34.70775 37.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2114 1 0.0 2114 2 0.0 2114 3 0.0 2114 4 0.0 2114 5 0.0 2114 6 0.0 2114 7 0.0 2114 8 0.0 2114 9 0.0 2114 10 0.0 2114 11 0.0 2114 12 0.0 2114 13 0.0 2114 14 0.0 2114 15 0.0 2114 16 0.0 2114 17 0.0 2114 18 0.0 2114 19 0.0 2114 20 0.0 2114 21 0.0 2114 22 0.0 2114 23 0.0 2114 24 0.0 2114 25 0.0 2114 26 0.0 2114 27 0.0 2114 28 0.0 2114 29 0.0 2114 30 0.0 2114 31 0.0 2114 32 0.0 2114 33 0.0 2114 34 0.0 2114 35 0.0 2114 36 0.0 2114 37 0.0 2114 38 0.0 2114 39 0.0 2114 40 0.0 2114 41 0.0 2114 42 0.0 2114 43 0.0 2114 44 0.0 2114 45 0.0 2114 46 0.0 2114 47 0.0 2114 48 0.0 2114 49 0.0 2114 50 0.0 2114 51 0.0 2114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 6.0 23 10.0 24 16.0 25 24.0 26 29.0 27 51.0 28 67.0 29 79.0 30 116.0 31 155.0 32 227.0 33 229.0 34 283.0 35 367.0 36 456.0 37 569.0 38 697.0 39 612.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.56084126189284 10.741111667501253 7.411116675012519 41.28693039559339 2 23.7 14.6 33.375 28.325 3 21.925 17.224999999999998 24.125 36.725 4 25.525 24.349999999999998 22.25 27.875 5 25.45 29.725 24.2 20.625 6 19.2 32.875 24.875 23.05 7 15.4 22.7 42.275 19.625 8 18.475 20.9 31.025000000000002 29.599999999999998 9 19.950000000000003 20.325 32.824999999999996 26.900000000000002 10 18.725 37.85 23.25 20.175 11 23.825 26.950000000000003 21.375 27.85 12 22.650000000000002 23.425 26.275 27.650000000000002 13 20.125 27.1 27.575 25.2 14 22.1 27.525 25.775 24.6 15 20.7 25.624999999999996 26.55 27.125 16 21.15 26.6 26.75 25.5 17 22.075 26.1 25.900000000000002 25.924999999999997 18 22.3 26.25 25.3 26.150000000000002 19 22.05 28.325 25.124999999999996 24.5 20 22.75 26.775 27.025 23.45 21 22.25 27.05 25.575 25.124999999999996 22 22.05 27.1 26.0 24.85 23 22.95 25.224999999999998 25.35 26.474999999999998 24 22.825 25.074999999999996 25.85 26.25 25 21.55 26.5 25.825 26.125 26 22.6 25.15 26.575 25.674999999999997 27 23.575 26.1 24.975 25.35 28 22.400000000000002 26.900000000000002 25.724999999999998 24.975 29 23.849999999999998 25.924999999999997 26.1 24.125 30 22.95 25.775 25.474999999999998 25.8 31 22.025 26.174999999999997 26.35 25.45 32 22.825 25.6 25.55 26.025 33 22.475 25.174999999999997 26.3 26.05 34 21.975 25.25 25.224999999999998 27.55 35 21.3 25.4 26.05 27.250000000000004 36 21.85 26.224999999999998 25.35 26.575 37 23.375 25.275 25.5 25.85 38 22.525000000000002 26.325 25.8 25.35 39 23.35 24.474999999999998 25.7 26.474999999999998 40 22.225 26.724999999999998 26.224999999999998 24.825 41 21.85 25.900000000000002 25.55 26.700000000000003 42 22.175 25.650000000000002 25.05 27.125 43 23.7 24.775 24.95 26.575 44 21.55 27.150000000000002 26.05 25.25 45 23.150000000000002 24.85 25.0 27.0 46 22.525000000000002 25.1 25.4 26.974999999999998 47 23.575 25.650000000000002 24.625 26.150000000000002 48 23.150000000000002 25.55 25.674999999999997 25.624999999999996 49 22.475 26.125 26.1 25.3 50 22.95 26.400000000000002 25.3 25.35 51 22.275 25.924999999999997 24.9 26.900000000000002 52 22.2 24.625 24.975 28.199999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 4.5 19 7.0 20 5.5 21 4.0 22 4.5 23 5.0 24 6.5 25 8.0 26 16.0 27 24.0 28 28.5 29 33.0 30 43.0 31 53.0 32 65.5 33 78.0 34 95.5 35 113.0 36 121.5 37 130.0 38 155.5 39 196.5 40 212.0 41 244.0 42 276.0 43 284.0 44 292.0 45 304.0 46 316.0 47 314.0 48 312.0 49 329.0 50 346.0 51 300.5 52 255.0 53 277.0 54 299.0 55 267.5 56 236.0 57 224.0 58 212.0 59 189.5 60 167.0 61 155.0 62 143.0 63 120.5 64 85.0 65 72.0 66 55.5 67 39.0 68 35.5 69 32.0 70 22.5 71 13.0 72 12.5 73 12.0 74 10.0 75 8.0 76 11.0 77 14.0 78 8.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.3568281938326 93.925 2 1.9694221300855144 3.8 3 0.466442083441306 1.35 4 0.1295672454003628 0.5 5 0.025913449080072558 0.125 6 0.051826898160145116 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 6 0.15 No Hit GGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAG 6 0.15 No Hit GTCCAACCAATTGGGAGAGAATCAATAGATTCCTTTTCGGGAGCGATTCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra Read 200000 spots for SRR5423341.sra Written 200000 spots for SRR5423341.sra SRR ids: ['SRR5423341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0byptvpa SRR5423341.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423341 file size 703962 SRR5423341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423341 SRR5423341_1.fastq Input file: SRR5423341_1.fastq trimmed: SRR5423341-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:40:29 2025 >> started Wed Feb 12 22:40:31 2025 >> done (1.811s) 4000000 reads processed; of these: 144 ( 0.00%) short reads filtered out after trimming by size control 201 ( 0.01%) empty reads filtered out after trimming by size control 3999655 (99.99%) reads available; of these: 159199 ( 3.98%) trimmed reads available after processing 3840456 (96.02%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 15 0.00% 26 13 0.00% 27 13 0.00% 28 15 0.00% 29 18 0.00% 30 23 0.00% 31 29 0.00% 32 49 0.00% 33 59 0.00% 34 62 0.00% 35 82 0.00% 36 83 0.00% 37 104 0.00% 38 134 0.00% 39 192 0.00% 40 228 0.01% 41 260 0.01% 42 367 0.01% 43 430 0.01% 44 777 0.02% 45 963 0.02% 46 1245 0.03% 47 1841 0.05% 48 3132 0.08% 49 6405 0.16% 50 18202 0.46% 51 124443 3.11% 52 3840456 96.02% 3999655 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.55 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 22:40:49 Started mapping on | Feb 12 22:40:49 Finished on | Feb 12 22:41:00 Mapping speed, Million of reads per hour | 1308.98 Number of input reads | 3999655 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3282370 Uniquely mapped reads % | 82.07% Average mapped length | 51.74 Number of splices: Total | 317538 Number of splices: Annotated (sjdb) | 313241 Number of splices: GT/AG | 310115 Number of splices: GC/AG | 6002 Number of splices: AT/AC | 477 Number of splices: Non-canonical | 944 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456079 % of reads mapped to multiple loci | 11.40% Number of reads mapped to too many loci | 137474 % of reads mapped to too many loci | 3.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 261206 261206 261206 N_multimapping 456079 456079 456079 N_noFeature 602509 3204911 667519 N_ambiguous 25466 234 12796 UnstrandedReadsAssigned:2654395 PositiveStrandReadsAssigned:77225 NegativeStrandReadsAssigned:2602055 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423341 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423341-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,655 reads, 2,871,490 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR5423341.ke.tsv 34699 SRR5423341.se.tsv 87100 total ==> SRR5423341.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 79.65 14.8727 Potri.005G024800.1.v4.1 1035 936 2 0.765657 Potri.004G059700.1.v4.1 961 862 10 4.15693 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.5206 7.62524 Potri.016G087400.1.v4.1 270 171 32 67.0554 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.214055 Potri.012G127500.1.v4.1 977 878 18 7.34612 ==> SRR5423341.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 30 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423341 completed mapping pipeline successfully