Starting /dee2/code/volunteer_pipeline.sh SRR5423342 current disk space = 3050474274816 free memory = 1574936336 SRR5423342 SRAfilesize 5231241b8e18923e483995d50ce3fc52 SRR5423342.sra SRR5423342.sra file validated SRR5423342 is single end SRR5423342 is conventional basespace SRR5423342 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47825 31.0 31.0 34.0 30.0 34.0 2 31.6865 31.0 31.0 34.0 30.0 34.0 3 31.9265 33.0 31.0 34.0 30.0 34.0 4 33.3385 35.0 33.0 37.0 26.0 37.0 5 34.93075 37.0 35.0 37.0 32.0 37.0 6 35.1805 37.0 35.0 37.0 32.0 37.0 7 35.35075 37.0 35.0 37.0 33.0 37.0 8 35.54325 37.0 35.0 37.0 33.0 37.0 9 37.21575 39.0 37.0 39.0 33.0 39.0 10 37.22775 39.0 37.0 39.0 34.0 39.0 11 37.215 39.0 37.0 39.0 33.0 39.0 12 37.01225 39.0 37.0 39.0 33.0 39.0 13 37.041 39.0 37.0 39.0 33.0 39.0 14 38.26975 40.0 38.0 41.0 33.0 41.0 15 38.22625 40.0 38.0 41.0 33.0 41.0 16 38.09925 40.0 37.0 41.0 33.0 41.0 17 38.27525 40.0 37.0 41.0 33.0 41.0 18 38.17 40.0 38.0 41.0 33.0 41.0 19 38.23025 40.0 38.0 41.0 34.0 41.0 20 38.26975 40.0 38.0 41.0 33.0 41.0 21 38.00525 40.0 37.0 41.0 33.0 41.0 22 37.993 40.0 37.0 41.0 33.0 41.0 23 38.2195 40.0 38.0 41.0 33.0 41.0 24 38.18425 40.0 38.0 41.0 33.0 41.0 25 38.11775 40.0 37.0 41.0 33.0 41.0 26 37.9085 40.0 37.0 41.0 33.0 41.0 27 37.957 40.0 37.0 41.0 33.0 41.0 28 37.38775 40.0 37.0 41.0 31.0 41.0 29 37.6565 40.0 37.0 41.0 32.0 41.0 30 37.41225 40.0 37.0 41.0 32.0 41.0 31 37.45175 40.0 37.0 41.0 31.0 41.0 32 37.45525 40.0 37.0 41.0 31.0 41.0 33 37.617 40.0 37.0 41.0 32.0 41.0 34 37.56425 40.0 37.0 41.0 32.0 41.0 35 37.29375 40.0 36.0 41.0 30.0 41.0 36 37.2185 40.0 36.0 41.0 31.0 41.0 37 37.1035 39.0 36.0 41.0 30.0 41.0 38 37.21425 39.0 36.0 41.0 31.0 41.0 39 37.202 39.0 36.0 41.0 31.0 41.0 40 36.86125 39.0 36.0 41.0 30.0 41.0 41 37.00225 39.0 36.0 41.0 30.0 41.0 42 36.9955 39.0 35.0 41.0 30.0 41.0 43 36.96325 39.0 35.0 41.0 30.0 41.0 44 36.6505 39.0 35.0 40.0 30.0 41.0 45 36.55125 39.0 35.0 40.0 30.0 41.0 46 36.71825 39.0 35.0 40.0 30.0 41.0 47 36.667 39.0 35.0 40.0 30.0 41.0 48 36.65525 39.0 35.0 40.0 30.0 41.0 49 36.63375 39.0 35.0 40.0 30.0 41.0 50 36.40475 39.0 35.0 40.0 29.0 41.0 51 36.13425 39.0 35.0 40.0 29.0 41.0 52 35.0735 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2212 1 0.0 2212 2 0.0 2212 3 0.0 2212 4 0.0 2212 5 0.0 2212 6 0.0 2212 7 0.0 2212 8 0.0 2212 9 0.0 2212 10 0.0 2212 11 0.0 2212 12 0.0 2212 13 0.0 2212 14 0.0 2212 15 0.0 2212 16 0.0 2212 17 0.0 2212 18 0.0 2212 19 0.0 2212 20 0.0 2212 21 0.0 2212 22 0.0 2212 23 0.0 2212 24 0.0 2212 25 0.0 2212 26 0.0 2212 27 0.0 2212 28 0.0 2212 29 0.0 2212 30 0.0 2212 31 0.0 2212 32 0.0 2212 33 0.0 2212 34 0.0 2212 35 0.0 2212 36 0.0 2212 37 0.0 2212 38 0.0 2212 39 0.0 2212 40 0.0 2212 41 0.0 2212 42 0.0 2212 43 0.0 2212 44 0.0 2212 45 0.0 2212 46 0.0 2212 47 0.0 2212 48 0.0 2212 49 0.0 2212 50 0.0 2212 51 0.0 2212 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 4.0 21 3.0 22 5.0 23 6.0 24 10.0 25 21.0 26 27.0 27 27.0 28 34.0 29 57.0 30 65.0 31 100.0 32 134.0 33 191.0 34 222.0 35 273.0 36 353.0 37 496.0 38 758.0 39 1208.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.75093867334167 10.212765957446807 7.334167709637046 41.702127659574465 2 25.025 14.299999999999999 33.175 27.500000000000004 3 22.225 18.45 22.650000000000002 36.675000000000004 4 25.15 26.200000000000003 21.6 27.05 5 25.05 30.7 24.0 20.25 6 19.650000000000002 31.624999999999996 25.424999999999997 23.3 7 15.8 22.475 40.8 20.925 8 17.424999999999997 21.55 32.25 28.775000000000002 9 20.025000000000002 21.625 32.1 26.25 10 19.725 37.25 22.775000000000002 20.25 11 24.65 26.35 21.475 27.525 12 21.975 24.125 26.0 27.900000000000002 13 20.125 25.75 28.275 25.85 14 20.724999999999998 27.650000000000002 26.75 24.875 15 21.0 26.0 26.625 26.375 16 21.15 26.75 25.650000000000002 26.450000000000003 17 22.1 25.525 26.924999999999997 25.45 18 22.85 25.85 26.075 25.224999999999998 19 22.55 25.75 25.525 26.174999999999997 20 21.325 26.275 26.775 25.624999999999996 21 21.575 25.825 26.174999999999997 26.424999999999997 22 21.8 26.724999999999998 25.25 26.224999999999998 23 22.15 27.525 25.825 24.5 24 23.1 25.424999999999997 25.5 25.974999999999998 25 22.075 26.3 25.1 26.525 26 21.45 26.025 26.825 25.7 27 22.650000000000002 25.15 25.7 26.5 28 23.425 25.525 25.650000000000002 25.4 29 22.55 26.924999999999997 26.924999999999997 23.599999999999998 30 23.5 23.95 26.55 26.0 31 24.0 25.45 25.25 25.3 32 22.275 27.05 25.45 25.224999999999998 33 23.1 24.65 25.624999999999996 26.625 34 21.525 26.25 25.224999999999998 27.0 35 21.95 25.874999999999996 25.525 26.650000000000002 36 20.95 25.275 25.35 28.425 37 21.175 25.35 26.125 27.35 38 23.025000000000002 24.45 25.650000000000002 26.875 39 22.3 26.05 25.275 26.375 40 21.675 25.35 26.075 26.900000000000002 41 21.825 25.35 26.25 26.575 42 21.75 23.775 26.950000000000003 27.525 43 22.825 24.875 25.474999999999998 26.825 44 22.15 26.85 26.35 24.65 45 23.474999999999998 25.025 25.224999999999998 26.275 46 22.975 24.224999999999998 25.4 27.400000000000002 47 24.099999999999998 25.85 23.875 26.174999999999997 48 22.25 25.55 26.325 25.874999999999996 49 22.075 24.875 25.224999999999998 27.825 50 22.325 25.85 25.324999999999996 26.5 51 21.4 25.15 24.95 28.499999999999996 52 23.925 26.150000000000002 25.424999999999997 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 2.0 3 1.5 4 1.0 5 0.5 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.5 17 1.0 18 3.5 19 6.0 20 5.5 21 5.0 22 7.0 23 9.0 24 11.0 25 13.0 26 17.5 27 22.0 28 31.5 29 41.0 30 47.0 31 53.0 32 62.5 33 72.0 34 82.5 35 93.0 36 111.0 37 129.0 38 139.5 39 192.5 40 235.0 41 243.5 42 252.0 43 257.5 44 263.0 45 283.0 46 303.0 47 319.0 48 335.0 49 332.5 50 330.0 51 312.5 52 295.0 53 302.0 54 309.0 55 287.0 56 265.0 57 249.5 58 234.0 59 197.5 60 161.0 61 149.5 62 138.0 63 113.0 64 79.5 65 71.0 66 60.0 67 49.0 68 35.5 69 22.0 70 17.0 71 12.0 72 14.0 73 16.0 74 14.0 75 12.0 76 7.5 77 3.0 78 3.0 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.71225670699631 91.925 2 2.130457653866386 4.05 3 0.6575486586007364 1.875 4 0.2630194634402946 1.0 5 0.21041557075223566 1.0 6 0.026301946344029457 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 5 0.125 No Hit CTCCGGTGTACTGCGCTCTCCAAGTGTGCTTGTTCCCCCCTTCTTCCTTACC 5 0.125 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 5 0.125 No Hit CAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCCCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra Read 200000 spots for SRR5423342.sra Written 200000 spots for SRR5423342.sra SRR ids: ['SRR5423342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1miqv0w SRR5423342.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423342 file size 703961 SRR5423342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423342 SRR5423342_1.fastq Input file: SRR5423342_1.fastq trimmed: SRR5423342-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:47:25 2025 >> started Wed Feb 12 22:47:27 2025 >> done (1.973s) 4000000 reads processed; of these: 141 ( 0.00%) short reads filtered out after trimming by size control 204 ( 0.01%) empty reads filtered out after trimming by size control 3999655 (99.99%) reads available; of these: 119536 ( 2.99%) trimmed reads available after processing 3880119 (97.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 5 0.00% 25 15 0.00% 26 7 0.00% 27 16 0.00% 28 9 0.00% 29 9 0.00% 30 16 0.00% 31 21 0.00% 32 27 0.00% 33 66 0.00% 34 61 0.00% 35 56 0.00% 36 72 0.00% 37 88 0.00% 38 100 0.00% 39 139 0.00% 40 156 0.00% 41 222 0.01% 42 366 0.01% 43 399 0.01% 44 672 0.02% 45 871 0.02% 46 992 0.02% 47 1610 0.04% 48 2744 0.07% 49 5641 0.14% 50 15357 0.38% 51 89775 2.24% 52 3880119 97.01% 3999655 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=22 prefix-density=0.28 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=31.91 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TTTCCAGTTTGTCGGTCCCCAATTATAAGTTCTCGTTGACCACGGCCTATAGGAACCAAGCTATCTACCGCTTTTAACCCTGTTTGCATAGGCTCGTGCACAGATTTACGTTCAATAATCCCAGGGGCTTTCACTTCGACACGTCTTCGCTCGTGATCGCTTAGAGCTCCTCTTCCATCAATAGGTACTCCCAAGGCGTCGACCACACGCCCTAGCATAGCCTTTCCCGCAGGAACATTCACAATAGATCCAGTTCGTTTGACAAGATCTCCTTCTTTA Started job on | Feb 12 22:47:39 Started mapping on | Feb 12 22:47:39 Finished on | Feb 12 22:47:45 Mapping speed, Million of reads per hour | 2399.79 Number of input reads | 3999655 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292951 Uniquely mapped reads % | 82.33% Average mapped length | 51.76 Number of splices: Total | 320813 Number of splices: Annotated (sjdb) | 316573 Number of splices: GT/AG | 313303 Number of splices: GC/AG | 6123 Number of splices: AT/AC | 483 Number of splices: Non-canonical | 904 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454801 % of reads mapped to multiple loci | 11.37% Number of reads mapped to too many loci | 138918 % of reads mapped to too many loci | 3.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 251903 251903 251903 N_multimapping 454801 454801 454801 N_noFeature 605166 3215206 670472 N_ambiguous 25349 226 12699 UnstrandedReadsAssigned:2662436 PositiveStrandReadsAssigned:77519 NegativeStrandReadsAssigned:2609780 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423342 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423342-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,655 reads, 2,953,191 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR5423342.ke.tsv 34699 SRR5423342.se.tsv 87100 total ==> SRR5423342.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 85 15.4605 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 5.44304 2.20401 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.4441 7.0501 Potri.016G087400.1.v4.1 270 171 39 79.6064 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 26 10.3361 ==> SRR5423342.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423342 completed mapping pipeline successfully