Starting /dee2/code/volunteer_pipeline.sh SRR5423343 current disk space = 3050469863424 free memory = 1580679852 SRR5423343 SRAfilesize 82af01c476457e7f5b0c8e557e869b48 SRR5423343.sra SRR5423343.sra file validated SRR5423343 is single end SRR5423343 is conventional basespace SRR5423343 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.97125 33.0 31.0 34.0 30.0 34.0 2 31.99375 34.0 31.0 34.0 30.0 34.0 3 32.0945 34.0 31.0 34.0 30.0 34.0 4 35.5935 37.0 35.0 37.0 33.0 37.0 5 35.5675 37.0 35.0 37.0 33.0 37.0 6 35.57525 37.0 35.0 37.0 33.0 37.0 7 35.64575 37.0 35.0 37.0 33.0 37.0 8 35.63825 37.0 35.0 37.0 33.0 37.0 9 37.10025 39.0 37.0 39.0 33.0 39.0 10 37.18975 39.0 37.0 39.0 33.0 39.0 11 37.21425 39.0 37.0 39.0 33.0 39.0 12 37.18475 39.0 37.0 39.0 33.0 39.0 13 37.10425 39.0 37.0 39.0 33.0 39.0 14 38.58475 40.0 38.0 41.0 34.0 41.0 15 38.50425 40.0 38.0 41.0 34.0 41.0 16 38.5375 40.0 38.0 41.0 34.0 41.0 17 38.4635 40.0 38.0 41.0 33.0 41.0 18 38.24475 40.0 38.0 41.0 33.0 41.0 19 38.32975 40.0 38.0 41.0 33.0 41.0 20 38.26425 40.0 38.0 41.0 33.0 41.0 21 38.37275 40.0 38.0 41.0 34.0 41.0 22 38.42725 40.0 38.0 41.0 34.0 41.0 23 38.22025 40.0 38.0 41.0 33.0 41.0 24 38.332 40.0 38.0 41.0 34.0 41.0 25 38.22725 40.0 38.0 41.0 33.0 41.0 26 38.2695 40.0 38.0 41.0 34.0 41.0 27 37.876 40.0 37.0 41.0 32.0 41.0 28 37.9165 40.0 37.0 41.0 33.0 41.0 29 37.71325 40.0 37.0 41.0 32.0 41.0 30 37.7555 40.0 37.0 41.0 32.0 41.0 31 37.698 40.0 37.0 41.0 32.0 41.0 32 37.755 40.0 37.0 41.0 33.0 41.0 33 37.7815 40.0 37.0 41.0 33.0 41.0 34 37.61575 40.0 37.0 41.0 32.0 41.0 35 37.6535 40.0 37.0 41.0 32.0 41.0 36 37.56325 40.0 37.0 41.0 31.0 41.0 37 37.4605 40.0 37.0 41.0 31.0 41.0 38 37.33075 40.0 36.0 41.0 31.0 41.0 39 37.403 40.0 36.0 41.0 31.0 41.0 40 37.16125 40.0 36.0 41.0 30.0 41.0 41 37.0745 39.0 36.0 41.0 30.0 41.0 42 36.8985 39.0 36.0 41.0 30.0 41.0 43 36.8315 39.0 35.0 41.0 30.0 41.0 44 36.74475 39.0 35.0 41.0 30.0 41.0 45 36.81375 39.0 35.0 41.0 30.0 41.0 46 36.85225 39.0 35.0 41.0 30.0 41.0 47 36.7715 39.0 35.0 41.0 30.0 41.0 48 36.77275 39.0 35.0 41.0 30.0 41.0 49 36.5935 39.0 35.0 40.0 30.0 41.0 50 36.46425 39.0 35.0 40.0 29.0 41.0 51 36.3235 39.0 35.0 40.0 29.0 41.0 52 35.02725 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2308 1 0.0 2308 2 0.0 2308 3 0.0 2308 4 0.0 2308 5 0.0 2308 6 0.0 2308 7 0.0 2308 8 0.0 2308 9 0.0 2308 10 0.0 2308 11 0.0 2308 12 0.0 2308 13 0.0 2308 14 0.0 2308 15 0.0 2308 16 0.0 2308 17 0.0 2308 18 0.0 2308 19 0.0 2308 20 0.0 2308 21 0.0 2308 22 0.0 2308 23 0.0 2308 24 0.0 2308 25 0.0 2308 26 0.0 2308 27 0.0 2308 28 0.0 2308 29 0.0 2308 30 0.0 2308 31 0.0 2308 32 0.0 2308 33 0.0 2308 34 0.0 2308 35 0.0 2308 36 0.0 2308 37 0.0 2308 38 0.0 2308 39 0.0 2308 40 0.0 2308 41 0.0 2308 42 0.0 2308 43 0.0 2308 44 0.0 2308 45 0.0 2308 46 0.0 2308 47 0.0 2308 48 0.0 2308 49 0.0 2308 50 0.0 2308 51 0.0 2308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 4.0 24 7.0 25 20.0 26 22.0 27 35.0 28 38.0 29 51.0 30 67.0 31 90.0 32 116.0 33 165.0 34 195.0 35 265.0 36 334.0 37 446.0 38 747.0 39 1388.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.675 10.325 8.375 42.625 2 24.75 14.099999999999998 33.525 27.625 3 24.575 17.4 23.075000000000003 34.949999999999996 4 25.900000000000002 25.224999999999998 21.2 27.675 5 25.3 30.525000000000002 23.65 20.525 6 19.575 31.55 25.6 23.275000000000002 7 15.15 22.525000000000002 42.975 19.35 8 18.2 22.95 30.075000000000003 28.775000000000002 9 19.525000000000002 20.75 33.575 26.150000000000002 10 18.475 37.9 24.075 19.55 11 23.474999999999998 26.8 21.575 28.15 12 22.95 23.375 25.924999999999997 27.750000000000004 13 19.6 27.0 28.675 24.725 14 21.425 25.525 27.950000000000003 25.1 15 20.45 27.0 27.150000000000002 25.4 16 22.3 26.05 25.874999999999996 25.775 17 21.675 26.325 26.474999999999998 25.525 18 22.1 26.200000000000003 26.5 25.2 19 22.400000000000002 26.224999999999998 26.325 25.05 20 22.325 25.2 25.2 27.275 21 22.275 25.624999999999996 26.1 26.0 22 21.375 27.250000000000004 26.25 25.124999999999996 23 22.400000000000002 26.400000000000002 24.775 26.424999999999997 24 22.8 24.2 26.8 26.200000000000003 25 22.575 25.924999999999997 24.75 26.75 26 21.224999999999998 25.900000000000002 27.425 25.45 27 22.6 26.200000000000003 26.674999999999997 24.525 28 23.0 25.4 26.6 25.0 29 23.125 25.4 26.400000000000002 25.074999999999996 30 22.125 25.374999999999996 27.1 25.4 31 21.625 25.85 26.400000000000002 26.125 32 22.225 26.0 26.474999999999998 25.3 33 23.1 25.174999999999997 25.224999999999998 26.5 34 21.325 25.575 26.700000000000003 26.400000000000002 35 20.95 25.4 26.3 27.35 36 21.475 26.450000000000003 25.650000000000002 26.424999999999997 37 21.975 24.8 26.424999999999997 26.8 38 23.425 24.474999999999998 24.7 27.400000000000002 39 23.55588897224306 24.5311327831958 25.55638909727432 26.356589147286826 40 21.880470117529384 25.93148287071768 27.206801700425103 24.981245311327832 41 22.355588897224308 26.206551637909474 26.081520380095025 25.35633908477119 42 22.7 25.224999999999998 25.5 26.575 43 22.05551387846962 26.93173293323331 24.18104526131533 26.831707926981746 44 22.8 26.8 23.974999999999998 26.424999999999997 45 20.980245061265315 24.60615153788447 26.531632908227053 27.881970492623154 46 22.605651412853213 24.306076519129782 24.93123280820205 28.157039259814955 47 23.53088272068017 25.531382845711427 24.63115778944736 26.30657664416104 48 24.281070267566893 24.60615153788447 25.656414103525883 25.456364091022753 49 21.510755377688845 25.03751875937969 25.887943971985994 27.56378189094547 50 22.305576394098527 27.031757939484873 25.55638909727432 25.10627656914228 51 22.56128064032016 25.012506253126567 24.912456228114056 27.51375687843922 52 23.425 25.924999999999997 23.75 26.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 2.0 16 2.5 17 3.0 18 2.5 19 2.0 20 5.0 21 8.0 22 8.5 23 9.0 24 13.0 25 17.0 26 23.5 27 30.0 28 32.5 29 35.0 30 52.0 31 69.0 32 68.0 33 67.0 34 85.0 35 103.0 36 114.0 37 125.0 38 154.5 39 196.0 40 208.0 41 232.0 42 256.0 43 277.5 44 299.0 45 303.0 46 307.0 47 308.5 48 310.0 49 314.5 50 319.0 51 304.0 52 289.0 53 298.5 54 308.0 55 281.5 56 255.0 57 229.5 58 204.0 59 186.0 60 168.0 61 150.5 62 133.0 63 106.5 64 78.0 65 76.0 66 57.5 67 39.0 68 37.5 69 36.0 70 28.5 71 21.0 72 19.5 73 18.0 74 11.5 75 5.0 76 5.0 77 5.0 78 6.0 79 7.0 80 3.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.025 41 0.025 42 0.0 43 0.025 44 0.0 45 0.025 46 0.025 47 0.025 48 0.025 49 0.05 50 0.025 51 0.05 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.48705758055995 91.325 2 2.4300052826201797 4.6 3 0.4754358161648178 1.35 4 0.3433703116745906 1.3 5 0.13206550449022716 0.625 6 0.10565240359218173 0.6 7 0.0 0.0 8 0.02641310089804543 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 8 0.2 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 6 0.15 No Hit CTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACT 6 0.15 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 6 0.15 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 6 0.15 No Hit GCCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTAC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit CCCGGTTCGAACAGGAGAAGTACGCCATGCTAATGTGCCTTGGATGATCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137811 spots for SRR5423343.sra Written 137811 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra Read 137806 spots for SRR5423343.sra Written 137806 spots for SRR5423343.sra SRR ids: ['SRR5423343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_isar9tcy SRR5423343.sra spots: 2756125 blocks: [[1, 137806], [137807, 275612], [275613, 413418], [413419, 551224], [551225, 689030], [689031, 826836], [826837, 964642], [964643, 1102448], [1102449, 1240254], [1240255, 1378060], [1378061, 1515866], [1515867, 1653672], [1653673, 1791478], [1791479, 1929284], [1929285, 2067090], [2067091, 2204896], [2204897, 2342702], [2342703, 2480508], [2480509, 2618314], [2618315, 2756125]] SRR5423343 file size 484677 SRR5423343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423343 SRR5423343_1.fastq Input file: SRR5423343_1.fastq trimmed: SRR5423343-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:38:54 2025 >> started Wed Feb 12 22:38:55 2025 >> done (1.396s) 2756125 reads processed; of these: 89 ( 0.00%) short reads filtered out after trimming by size control 124 ( 0.00%) empty reads filtered out after trimming by size control 2755912 (99.99%) reads available; of these: 64130 ( 2.33%) trimmed reads available after processing 2691782 (97.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 5 0.00% 31 7 0.00% 32 8 0.00% 33 10 0.00% 34 16 0.00% 35 12 0.00% 36 18 0.00% 37 23 0.00% 38 38 0.00% 39 39 0.00% 40 44 0.00% 41 82 0.00% 42 84 0.00% 43 117 0.00% 44 170 0.01% 45 264 0.01% 46 313 0.01% 47 600 0.02% 48 1081 0.04% 49 2474 0.09% 50 7464 0.27% 51 51238 1.86% 52 2691782 97.67% 2755912 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=23.49 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 22:39:06 Started mapping on | Feb 12 22:39:06 Finished on | Feb 12 22:39:11 Mapping speed, Million of reads per hour | 1984.26 Number of input reads | 2755912 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2270097 Uniquely mapped reads % | 82.37% Average mapped length | 51.77 Number of splices: Total | 220489 Number of splices: Annotated (sjdb) | 217559 Number of splices: GT/AG | 215162 Number of splices: GC/AG | 4337 Number of splices: AT/AC | 370 Number of splices: Non-canonical | 620 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311981 % of reads mapped to multiple loci | 11.32% Number of reads mapped to too many loci | 98175 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 173834 173834 173834 N_multimapping 311981 311981 311981 N_noFeature 418950 2217351 463191 N_ambiguous 17547 144 8905 UnstrandedReadsAssigned:1833600 PositiveStrandReadsAssigned:52602 NegativeStrandReadsAssigned:1798001 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423343 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423343-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,755,912 reads, 2,024,488 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR5423343.ke.tsv 34699 SRR5423343.se.tsv 87100 total ==> SRR5423343.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 51.6291 13.7251 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 5 2.9591 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 48.207 8.64722 Potri.016G087400.1.v4.1 270 171 22 65.6331 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.609496 Potri.012G127500.1.v4.1 977 878 18 10.4586 ==> SRR5423343.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 23 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423343 completed mapping pipeline successfully