Starting /dee2/code/volunteer_pipeline.sh SRR5423344 current disk space = 3050458312704 free memory = 1579185188 SRR5423344 SRAfilesize ef242939cd375034a0bd1ed303832b56 SRR5423344.sra SRR5423344.sra file validated SRR5423344 is single end SRR5423344 is conventional basespace SRR5423344 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.536 34.0 31.0 34.0 28.0 34.0 2 31.57775 34.0 31.0 34.0 27.0 34.0 3 32.3485 34.0 31.0 34.0 28.0 34.0 4 35.95225 37.0 35.0 37.0 35.0 37.0 5 35.95725 37.0 35.0 37.0 35.0 37.0 6 36.00425 37.0 35.0 37.0 35.0 37.0 7 36.07875 37.0 35.0 37.0 35.0 37.0 8 36.04275 37.0 35.0 37.0 35.0 37.0 9 37.7505 39.0 38.0 39.0 35.0 39.0 10 37.49075 39.0 37.0 39.0 35.0 39.0 11 37.67125 39.0 37.0 39.0 35.0 39.0 12 37.619 39.0 38.0 39.0 35.0 39.0 13 37.631 39.0 37.0 39.0 35.0 39.0 14 39.087 40.0 38.0 41.0 36.0 41.0 15 38.99575 40.0 38.0 41.0 36.0 41.0 16 38.97025 40.0 38.0 41.0 36.0 41.0 17 38.82725 40.0 38.0 41.0 35.0 41.0 18 38.849 40.0 38.0 41.0 35.0 41.0 19 38.958 40.0 38.0 41.0 35.0 41.0 20 38.82375 40.0 38.0 41.0 35.0 41.0 21 38.802 40.0 38.0 41.0 35.0 41.0 22 38.809 40.0 38.0 41.0 35.0 41.0 23 38.7625 40.0 38.0 41.0 35.0 41.0 24 38.71525 40.0 38.0 41.0 34.0 41.0 25 38.57575 40.0 38.0 41.0 34.0 41.0 26 38.5795 40.0 38.0 41.0 34.0 41.0 27 38.531 40.0 38.0 41.0 34.0 41.0 28 38.36475 40.0 38.0 41.0 34.0 41.0 29 38.41825 40.0 38.0 41.0 34.0 41.0 30 38.30925 40.0 38.0 41.0 34.0 41.0 31 38.2715 40.0 38.0 41.0 34.0 41.0 32 38.221 40.0 38.0 41.0 33.0 41.0 33 38.1205 40.0 38.0 41.0 33.0 41.0 34 38.0275 40.0 38.0 41.0 33.0 41.0 35 38.031 40.0 38.0 41.0 33.0 41.0 36 37.96975 40.0 38.0 41.0 33.0 41.0 37 37.87025 40.0 38.0 41.0 32.0 41.0 38 37.76275 40.0 37.0 41.0 32.0 41.0 39 37.607 40.0 37.0 41.0 32.0 41.0 40 37.63975 40.0 37.0 41.0 32.0 41.0 41 37.56475 40.0 37.0 41.0 31.0 41.0 42 37.28175 40.0 37.0 41.0 31.0 41.0 43 37.09725 40.0 36.0 41.0 30.0 41.0 44 37.0675 40.0 36.0 41.0 31.0 41.0 45 37.059 40.0 36.0 41.0 30.0 41.0 46 36.78625 40.0 36.0 41.0 30.0 41.0 47 36.64625 39.0 36.0 41.0 29.0 41.0 48 36.50675 39.0 35.0 41.0 29.0 41.0 49 36.321 39.0 35.0 41.0 28.0 41.0 50 36.37275 39.0 35.0 41.0 28.0 41.0 51 36.1505 39.0 35.0 41.0 27.0 41.0 52 33.97325 37.0 32.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 4.0 21 1.0 22 3.0 23 8.0 24 11.0 25 18.0 26 18.0 27 24.0 28 34.0 29 41.0 30 57.0 31 91.0 32 98.0 33 125.0 34 154.0 35 184.0 36 304.0 37 412.0 38 844.0 39 1562.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.32690246516613 10.262593783494104 7.127545551982852 42.28295819935691 2 24.15 14.075 32.425 29.349999999999998 3 23.150000000000002 17.625 22.25 36.975 4 26.474999999999998 25.025 20.9 27.6 5 24.3 30.775000000000002 23.575 21.349999999999998 6 19.225 32.1 24.825 23.849999999999998 7 15.625 21.3 42.225 20.849999999999998 8 17.549999999999997 21.825 31.874999999999996 28.749999999999996 9 18.4 20.25 34.375 26.974999999999998 10 18.95 35.699999999999996 25.074999999999996 20.275000000000002 11 23.599999999999998 27.55 21.425 27.425 12 22.55 22.25 26.224999999999998 28.975 13 20.625 26.775 26.625 25.974999999999998 14 21.55 27.275 27.150000000000002 24.025 15 22.0 26.075 25.900000000000002 26.025 16 22.15 26.375 25.424999999999997 26.05 17 22.6 26.275 25.575 25.55 18 23.3 24.875 26.025 25.8 19 21.8 26.400000000000002 25.5 26.3 20 23.05 25.874999999999996 26.275 24.8 21 22.650000000000002 25.95 25.724999999999998 25.674999999999997 22 21.675 25.924999999999997 26.125 26.275 23 22.825 26.474999999999998 25.074999999999996 25.624999999999996 24 21.575 26.55 24.875 27.0 25 23.225 24.675 25.025 27.075 26 23.325000000000003 24.675 25.55 26.450000000000003 27 22.650000000000002 25.775 26.974999999999998 24.6 28 22.325 25.474999999999998 25.7 26.5 29 21.95 25.974999999999998 27.275 24.8 30 22.875 24.5 25.424999999999997 27.200000000000003 31 23.0 25.0 25.95 26.05 32 22.975 26.025 25.55 25.45 33 22.6 23.974999999999998 26.950000000000003 26.474999999999998 34 22.275 25.35 25.674999999999997 26.700000000000003 35 23.075000000000003 24.075 26.075 26.775 36 21.6 24.725 26.325 27.35 37 21.575 24.0 27.224999999999998 27.200000000000003 38 22.525000000000002 24.375 25.85 27.250000000000004 39 22.275 25.15 26.424999999999997 26.150000000000002 40 21.475 25.825 26.85 25.85 41 22.5 25.174999999999997 25.025 27.3 42 22.125 25.424999999999997 25.55 26.900000000000002 43 22.400000000000002 24.099999999999998 26.625 26.875 44 22.675 26.325 25.45 25.55 45 22.0 24.575 26.724999999999998 26.700000000000003 46 22.425 24.675 26.1 26.8 47 23.974999999999998 26.0 24.55 25.474999999999998 48 23.775 24.725 25.525 25.974999999999998 49 22.225 25.575 24.575 27.625 50 22.25 25.424999999999997 24.575 27.750000000000004 51 21.725 25.85 25.1 27.325 52 23.125 25.174999999999997 25.724999999999998 25.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 3.5 21 5.0 22 8.0 23 11.0 24 11.5 25 12.0 26 16.5 27 21.0 28 26.0 29 31.0 30 39.0 31 47.0 32 54.0 33 61.0 34 78.0 35 95.0 36 119.0 37 143.0 38 152.5 39 176.5 40 191.0 41 222.5 42 254.0 43 266.5 44 279.0 45 300.0 46 321.0 47 326.5 48 332.0 49 331.5 50 331.0 51 333.5 52 336.0 53 329.0 54 322.0 55 287.5 56 253.0 57 234.5 58 216.0 59 190.5 60 165.0 61 151.0 62 137.0 63 111.5 64 72.5 65 59.0 66 53.0 67 47.0 68 36.0 69 25.0 70 24.0 71 23.0 72 18.0 73 13.0 74 8.5 75 4.0 76 4.5 77 5.0 78 4.5 79 4.0 80 2.5 81 1.0 82 1.5 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.68320710368242 92.55 2 2.5332985113606687 4.8500000000000005 3 0.47009663097414467 1.35 4 0.26116479498563594 1.0 5 0.05223295899712719 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAAACCACCGCCTCTCGGGCCCCCGACTGATTCTACCATAGAGGCCGAC 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra Read 200000 spots for SRR5423344.sra Written 200000 spots for SRR5423344.sra SRR ids: ['SRR5423344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ri63jt7r SRR5423344.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423344 file size 703989 SRR5423344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423344 SRR5423344_1.fastq Input file: SRR5423344_1.fastq trimmed: SRR5423344-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 22:56:13 2025 >> started Wed Feb 12 22:56:15 2025 >> done (1.969s) 4000000 reads processed; of these: 165 ( 0.00%) short reads filtered out after trimming by size control 208 ( 0.01%) empty reads filtered out after trimming by size control 3999627 (99.99%) reads available; of these: 99302 ( 2.48%) trimmed reads available after processing 3900325 (97.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 9 0.00% 26 8 0.00% 27 11 0.00% 28 17 0.00% 29 7 0.00% 30 5 0.00% 31 19 0.00% 32 28 0.00% 33 27 0.00% 34 46 0.00% 35 50 0.00% 36 62 0.00% 37 65 0.00% 38 100 0.00% 39 151 0.00% 40 149 0.00% 41 187 0.00% 42 264 0.01% 43 284 0.01% 44 503 0.01% 45 662 0.02% 46 835 0.02% 47 1199 0.03% 48 2076 0.05% 49 4597 0.11% 50 12268 0.31% 51 75654 1.89% 52 3900325 97.52% 3999627 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=2.4 sequence=ACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.82 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 22:56:26 Started mapping on | Feb 12 22:56:26 Finished on | Feb 12 22:56:31 Mapping speed, Million of reads per hour | 2879.73 Number of input reads | 3999627 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3292011 Uniquely mapped reads % | 82.31% Average mapped length | 51.77 Number of splices: Total | 319113 Number of splices: Annotated (sjdb) | 314947 Number of splices: GT/AG | 311574 Number of splices: GC/AG | 6186 Number of splices: AT/AC | 477 Number of splices: Non-canonical | 876 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453335 % of reads mapped to multiple loci | 11.33% Number of reads mapped to too many loci | 143210 % of reads mapped to too many loci | 3.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254281 254281 254281 N_multimapping 453335 453335 453335 N_noFeature 608338 3213483 674700 N_ambiguous 25383 236 12999 UnstrandedReadsAssigned:2658290 PositiveStrandReadsAssigned:78292 NegativeStrandReadsAssigned:2604312 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423344 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423344-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,627 reads, 2,965,278 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR5423344.ke.tsv 34699 SRR5423344.se.tsv 87100 total ==> SRR5423344.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 99 17.897 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 11 4.42696 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.5984 8.61163 Potri.016G087400.1.v4.1 270 171 29 58.8331 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 22 8.69257 ==> SRR5423344.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 49 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR5423344 completed mapping pipeline successfully