Starting /dee2/code/volunteer_pipeline.sh SRR5423345 current disk space = 3050509283328 free memory = 1579481120 SRR5423345 SRAfilesize 4da8893c2f534f305c17048a14074c2d SRR5423345.sra SRR5423345.sra file validated SRR5423345 is single end SRR5423345 is conventional basespace SRR5423345 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.55475 34.0 31.0 34.0 16.0 34.0 2 30.99875 34.0 31.0 34.0 19.0 34.0 3 32.08925 34.0 31.0 34.0 28.0 34.0 4 35.81225 37.0 35.0 37.0 35.0 37.0 5 35.946 37.0 35.0 37.0 35.0 37.0 6 35.91125 37.0 35.0 37.0 35.0 37.0 7 35.924 37.0 35.0 37.0 35.0 37.0 8 35.95525 37.0 35.0 37.0 35.0 37.0 9 37.78625 39.0 38.0 39.0 35.0 39.0 10 37.67375 39.0 38.0 39.0 35.0 39.0 11 37.82275 39.0 38.0 39.0 35.0 39.0 12 37.81075 39.0 38.0 39.0 35.0 39.0 13 37.68825 39.0 38.0 39.0 35.0 39.0 14 39.136 40.0 39.0 41.0 36.0 41.0 15 39.0545 40.0 39.0 41.0 36.0 41.0 16 38.9715 40.0 38.0 41.0 35.0 41.0 17 38.98175 40.0 38.0 41.0 36.0 41.0 18 38.99025 40.0 38.0 41.0 36.0 41.0 19 38.891 40.0 38.0 41.0 35.0 41.0 20 38.87125 40.0 38.0 41.0 35.0 41.0 21 38.788 40.0 38.0 41.0 35.0 41.0 22 38.8495 40.0 38.0 41.0 35.0 41.0 23 38.69075 40.0 38.0 41.0 34.0 41.0 24 38.58925 40.0 38.0 41.0 34.0 41.0 25 38.52475 40.0 38.0 41.0 34.0 41.0 26 38.553 40.0 38.0 41.0 34.0 41.0 27 38.38775 40.0 38.0 41.0 34.0 41.0 28 38.14025 40.0 38.0 41.0 33.0 41.0 29 38.30275 40.0 38.0 41.0 34.0 41.0 30 38.09175 40.0 38.0 41.0 33.0 41.0 31 37.99375 40.0 38.0 41.0 33.0 41.0 32 37.68575 40.0 38.0 41.0 32.0 41.0 33 37.6955 40.0 37.0 41.0 33.0 41.0 34 37.542 40.0 37.0 41.0 32.0 41.0 35 37.65 40.0 37.0 41.0 32.0 41.0 36 37.53 40.0 37.0 41.0 32.0 41.0 37 37.36875 40.0 37.0 41.0 31.0 41.0 38 37.03175 40.0 37.0 41.0 30.0 41.0 39 37.13525 40.0 36.0 41.0 30.0 41.0 40 37.14075 40.0 36.0 41.0 31.0 41.0 41 37.1895 40.0 37.0 41.0 30.0 41.0 42 37.053 40.0 37.0 41.0 30.0 41.0 43 36.868 40.0 36.0 41.0 30.0 41.0 44 36.69375 40.0 36.0 41.0 30.0 41.0 45 36.4935 40.0 35.0 41.0 29.0 41.0 46 36.44075 39.0 36.0 41.0 28.0 41.0 47 36.03 39.0 35.0 41.0 27.0 41.0 48 36.004 39.0 35.0 41.0 26.0 41.0 49 36.0665 39.0 35.0 41.0 27.0 41.0 50 36.09525 39.0 35.0 41.0 28.0 41.0 51 35.87325 39.0 35.0 41.0 26.0 41.0 52 33.72325 37.0 32.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 13.0 22 7.0 23 12.0 24 12.0 25 17.0 26 27.0 27 35.0 28 40.0 29 39.0 30 61.0 31 86.0 32 107.0 33 120.0 34 171.0 35 222.0 36 289.0 37 432.0 38 784.0 39 1513.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.99503585217871 12.60341974627689 5.65361279646994 38.74793160507446 2 21.375 13.675 35.4 29.549999999999997 3 19.85 18.125 26.05 35.975 4 23.075000000000003 27.525 22.05 27.35 5 25.45 31.6 22.425 20.525 6 20.775 34.2 21.9 23.125 7 15.950000000000001 24.175 41.025 18.85 8 16.950000000000003 22.25 31.35 29.45 9 18.625 22.15 33.225 26.0 10 19.575 38.375 22.675 19.375 11 22.25 28.275 22.400000000000002 27.075 12 21.625 24.7 26.85 26.825 13 20.200000000000003 27.474999999999998 27.325 25.0 14 19.900000000000002 27.1 26.825 26.174999999999997 15 21.575 26.05 26.5 25.874999999999996 16 20.974999999999998 27.250000000000004 25.5 26.275 17 21.775 26.424999999999997 25.724999999999998 26.075 18 21.2 26.825 24.625 27.35 19 22.125 27.900000000000002 24.675 25.3 20 21.525 25.474999999999998 27.250000000000004 25.75 21 21.65 25.650000000000002 26.325 26.375 22 21.05 27.400000000000002 25.3 26.25 23 20.825 26.525 26.775 25.874999999999996 24 21.25 26.8 24.9 27.05 25 21.099999999999998 26.150000000000002 26.025 26.724999999999998 26 21.349999999999998 24.85 27.450000000000003 26.35 27 21.9 27.400000000000002 24.775 25.924999999999997 28 22.75 26.0 26.0 25.25 29 21.375 26.275 27.575 24.775 30 21.25 26.075 26.35 26.325 31 21.325 26.325 27.1 25.25 32 22.45 27.275 25.575 24.7 33 22.5 26.150000000000002 24.875 26.474999999999998 34 21.975 27.1 25.374999999999996 25.55 35 20.974999999999998 26.625 26.775 25.624999999999996 36 22.775000000000002 26.5 23.799999999999997 26.924999999999997 37 22.475 27.200000000000003 24.55 25.775 38 22.650000000000002 26.0 26.25 25.1 39 20.625 26.575 25.95 26.85 40 22.025 27.075 24.975 25.924999999999997 41 21.725 25.924999999999997 26.025 26.325 42 22.025 26.325 25.124999999999996 26.525 43 22.3 26.724999999999998 24.6 26.375 44 22.95 25.7 25.900000000000002 25.45 45 21.349999999999998 25.900000000000002 25.2 27.55 46 22.975 25.575 24.325 27.125 47 22.225 25.974999999999998 25.174999999999997 26.625 48 22.6 25.8 25.0 26.6 49 22.425 26.650000000000002 24.55 26.375 50 21.45 26.3 25.324999999999996 26.924999999999997 51 22.400000000000002 25.4 24.9 27.3 52 22.425 26.125 24.375 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 18.0 1 14.0 2 10.0 3 10.0 4 10.0 5 6.0 6 2.0 7 2.0 8 2.0 9 2.5 10 3.0 11 2.0 12 1.0 13 2.5 14 2.5 15 1.0 16 1.0 17 1.0 18 3.0 19 5.0 20 5.5 21 6.0 22 8.0 23 10.0 24 13.5 25 17.0 26 24.5 27 32.0 28 35.5 29 39.0 30 48.0 31 57.0 32 64.0 33 71.0 34 92.5 35 114.0 36 133.0 37 152.0 38 172.0 39 203.0 40 214.0 41 229.5 42 245.0 43 251.5 44 258.0 45 286.0 46 314.0 47 301.0 48 288.0 49 297.0 50 306.0 51 305.5 52 305.0 53 298.5 54 292.0 55 263.5 56 235.0 57 219.0 58 203.0 59 186.0 60 169.0 61 151.5 62 134.0 63 114.0 64 80.0 65 66.0 66 51.0 67 36.0 68 35.5 69 35.0 70 23.0 71 11.0 72 13.0 73 15.0 74 13.0 75 11.0 76 8.0 77 5.0 78 5.0 79 5.0 80 5.0 81 5.0 82 4.0 83 3.0 84 2.5 85 2.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 96.87745998425609 92.30000000000001 2 2.2303857255313564 4.25 3 0.5247966413014957 1.5 4 0.23615848858567304 0.8999999999999999 5 0.05247966413014957 0.25 6 0.026239832065074783 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05247966413014957 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 13 0.325 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 6 0.15 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 5 0.125 No Hit GCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra Read 200000 spots for SRR5423345.sra Written 200000 spots for SRR5423345.sra SRR ids: ['SRR5423345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8dqzim1h SRR5423345.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423345 file size 703967 SRR5423345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423345 SRR5423345_1.fastq Input file: SRR5423345_1.fastq trimmed: SRR5423345-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:14:18 2025 >> started Wed Feb 12 23:19:19 2025 >> done (301.216s) 4000000 reads processed; of these: 103 ( 0.00%) short reads filtered out after trimming by size control 2623 ( 0.07%) empty reads filtered out after trimming by size control 3997274 (99.93%) reads available; of these: 120889 ( 3.02%) trimmed reads available after processing 3876385 (96.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 4 0.00% 23 1 0.00% 24 9 0.00% 25 7 0.00% 26 7 0.00% 27 15 0.00% 28 9 0.00% 29 19 0.00% 30 27 0.00% 31 26 0.00% 32 30 0.00% 33 23 0.00% 34 64 0.00% 35 67 0.00% 36 60 0.00% 37 106 0.00% 38 95 0.00% 39 117 0.00% 40 170 0.00% 41 224 0.01% 42 279 0.01% 43 370 0.01% 44 505 0.01% 45 738 0.02% 46 1106 0.03% 47 1694 0.04% 48 2789 0.07% 49 5601 0.14% 50 15044 0.38% 51 91666 2.29% 52 3876385 96.98% 3997274 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=1.04 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=19.70 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGA Started job on | Feb 12 23:25:22 Started mapping on | Feb 12 23:25:33 Finished on | Feb 12 23:58:48 Mapping speed, Million of reads per hour | 7.21 Number of input reads | 3997274 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3274959 Uniquely mapped reads % | 81.93% Average mapped length | 51.74 Number of splices: Total | 299792 Number of splices: Annotated (sjdb) | 294011 Number of splices: GT/AG | 292196 Number of splices: GC/AG | 5893 Number of splices: AT/AC | 481 Number of splices: Non-canonical | 1222 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430353 % of reads mapped to multiple loci | 10.77% Number of reads mapped to too many loci | 141790 % of reads mapped to too many loci | 3.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 291962 291962 291962 N_multimapping 430353 430353 430353 N_noFeature 599619 3154597 711261 N_ambiguous 18254 135 9414 UnstrandedReadsAssigned:2657086 PositiveStrandReadsAssigned:120227 NegativeStrandReadsAssigned:2554284 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423345 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423345-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,274 reads, 2,855,614 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR5423345.ke.tsv 34699 SRR5423345.se.tsv 87100 total ==> SRR5423345.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 304 57.2142 Potri.005G024800.1.v4.1 1035 936 29 11.1899 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 58.4699 7.4252 Potri.016G087400.1.v4.1 270 171 22 46.4657 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14 3.02049 Potri.012G127500.1.v4.1 977 878 149 61.2911 ==> SRR5423345.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 49 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423345 completed mapping pipeline successfully