Starting /dee2/code/volunteer_pipeline.sh SRR5423346 current disk space = 3049353228288 free memory = 1579035164 SRR5423346 SRAfilesize 29a5af372737eb410e9e94048f700f01 SRR5423346.sra SRR5423346.sra file validated SRR5423346 is single end SRR5423346 is conventional basespace SRR5423346 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5225 31.0 31.0 34.0 30.0 34.0 2 31.68 31.0 31.0 34.0 30.0 34.0 3 31.66925 31.0 31.0 34.0 30.0 34.0 4 33.8735 35.0 35.0 37.0 28.0 37.0 5 34.8825 35.0 35.0 37.0 32.0 37.0 6 35.08525 37.0 35.0 37.0 32.0 37.0 7 35.24425 37.0 35.0 37.0 32.0 37.0 8 35.3055 37.0 35.0 37.0 32.0 37.0 9 36.8235 39.0 37.0 39.0 33.0 39.0 10 36.70925 39.0 37.0 39.0 32.0 39.0 11 36.86175 39.0 37.0 39.0 32.0 39.0 12 36.8395 39.0 37.0 39.0 32.0 39.0 13 36.843 39.0 37.0 39.0 32.0 39.0 14 37.79775 40.0 37.0 41.0 32.0 41.0 15 37.86375 40.0 37.0 41.0 33.0 41.0 16 37.8315 40.0 37.0 41.0 33.0 41.0 17 37.91225 40.0 37.0 41.0 33.0 41.0 18 37.738 40.0 37.0 41.0 32.0 41.0 19 37.887 40.0 37.0 41.0 33.0 41.0 20 37.827 40.0 37.0 41.0 32.0 41.0 21 37.8385 40.0 37.0 41.0 33.0 41.0 22 37.6955 39.0 37.0 41.0 32.0 41.0 23 37.4825 39.0 36.0 41.0 32.0 41.0 24 37.7 40.0 37.0 41.0 32.0 41.0 25 37.543 39.0 37.0 41.0 32.0 41.0 26 37.52925 39.0 37.0 41.0 32.0 41.0 27 37.382 39.0 36.0 41.0 32.0 41.0 28 37.3245 39.0 36.0 41.0 32.0 41.0 29 37.03275 39.0 36.0 41.0 30.0 41.0 30 37.157 39.0 36.0 41.0 31.0 41.0 31 37.27225 39.0 36.0 41.0 31.0 41.0 32 37.39125 39.0 36.0 41.0 32.0 41.0 33 37.24225 39.0 36.0 41.0 31.0 41.0 34 37.12525 39.0 36.0 41.0 31.0 41.0 35 36.9475 39.0 36.0 41.0 30.0 41.0 36 36.49325 39.0 35.0 41.0 30.0 41.0 37 36.81825 39.0 35.0 41.0 30.0 41.0 38 37.00725 39.0 35.0 41.0 30.0 41.0 39 36.7695 39.0 35.0 40.0 30.0 41.0 40 36.372 39.0 35.0 40.0 30.0 41.0 41 36.31525 38.0 35.0 40.0 30.0 41.0 42 36.48 39.0 35.0 40.0 30.0 41.0 43 36.653 39.0 35.0 40.0 30.0 41.0 44 36.50775 39.0 35.0 40.0 30.0 41.0 45 36.46925 39.0 35.0 40.0 30.0 41.0 46 36.48225 39.0 35.0 40.0 30.0 41.0 47 36.33075 38.0 35.0 40.0 30.0 41.0 48 36.2745 38.0 35.0 40.0 30.0 41.0 49 36.3295 39.0 35.0 40.0 29.0 41.0 50 36.26725 38.0 35.0 40.0 29.0 41.0 51 36.31525 38.0 35.0 40.0 29.0 41.0 52 35.2075 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1114 1 0.0 1114 2 0.0 1114 3 0.0 1114 4 0.0 1114 5 0.0 1114 6 0.0 1114 7 0.0 1114 8 0.0 1114 9 0.0 1114 10 0.0 1114 11 0.0 1114 12 0.0 1114 13 0.0 1114 14 0.0 1114 15 0.0 1114 16 0.0 1114 17 0.0 1114 18 0.0 1114 19 0.0 1114 20 0.0 1114 21 0.0 1114 22 0.0 1114 23 0.0 1114 24 0.0 1114 25 0.0 1114 26 0.0 1114 27 0.0 1114 28 0.0 1114 29 0.0 1114 30 0.0 1114 31 0.0 1114 32 0.0 1114 33 0.0 1114 34 0.0 1114 35 0.0 1114 36 0.0 1114 37 0.0 1114 38 0.0 1114 39 0.0 1114 40 0.0 1114 41 0.0 1114 42 0.0 1114 43 0.0 1114 44 0.0 1114 45 0.0 1114 46 0.0 1114 47 0.0 1114 48 0.0 1114 49 0.0 1114 50 0.0 1114 51 0.0 1114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 3.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 9.0 24 7.0 25 16.0 26 21.0 27 47.0 28 39.0 29 70.0 30 90.0 31 106.0 32 171.0 33 202.0 34 252.0 35 346.0 36 346.0 37 479.0 38 709.0 39 1080.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.848234410217884 13.999499123466066 5.659904833458553 38.4923616328575 2 20.7 15.325 34.5 29.475 3 17.8 19.525000000000002 27.0 35.675000000000004 4 22.45 26.924999999999997 22.575 28.050000000000004 5 25.2 30.55 23.575 20.674999999999997 6 19.375 35.325 23.025000000000002 22.275 7 14.625 25.8 41.199999999999996 18.375 8 16.875 24.125 29.675 29.325000000000003 9 18.55 21.95 32.225 27.275 10 18.85 38.224999999999994 23.549999999999997 19.375 11 22.825 28.499999999999996 21.175 27.500000000000004 12 20.65 24.325 27.425 27.6 13 19.875 28.875 27.075 24.175 14 20.775 27.35 27.700000000000003 24.175 15 20.075000000000003 28.775000000000002 25.45 25.7 16 20.65 27.325 26.325 25.7 17 21.025 27.575 25.324999999999996 26.075 18 21.25 26.875 25.074999999999996 26.8 19 21.4 27.85 27.075 23.674999999999997 20 21.45 27.474999999999998 24.975 26.1 21 21.25 27.3 26.0 25.45 22 22.400000000000002 27.625 25.224999999999998 24.75 23 20.95 27.224999999999998 26.325 25.5 24 22.925 25.900000000000002 25.124999999999996 26.05 25 21.525 27.975 24.825 25.674999999999997 26 20.8 27.075 24.625 27.500000000000004 27 20.05 27.1 26.275 26.575 28 22.475 27.3 25.35 24.875 29 22.575 26.375 24.725 26.325 30 21.45 26.6 25.474999999999998 26.474999999999998 31 22.375 26.924999999999997 24.55 26.150000000000002 32 21.8 26.025 25.8 26.375 33 21.7 26.650000000000002 26.05 25.6 34 21.75 26.75 24.85 26.650000000000002 35 21.05 26.900000000000002 25.525 26.525 36 21.925 26.05 24.85 27.175 37 22.325 26.5 26.174999999999997 25.0 38 22.900000000000002 26.75 24.05 26.3 39 22.325 25.3 26.05 26.325 40 22.625 26.6 23.599999999999998 27.175 41 22.650000000000002 25.924999999999997 24.775 26.650000000000002 42 20.424999999999997 25.2 27.500000000000004 26.875 43 21.275 26.8 25.974999999999998 25.95 44 22.125 25.85 25.55 26.474999999999998 45 21.2 26.8 25.624999999999996 26.375 46 21.825 27.400000000000002 25.4 25.374999999999996 47 23.474999999999998 25.2 25.1 26.224999999999998 48 22.0 25.275 25.75 26.974999999999998 49 22.075 26.974999999999998 24.6 26.35 50 22.3 26.674999999999997 24.2 26.825 51 21.775 26.75 22.875 28.599999999999998 52 21.3 27.150000000000002 24.7 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 12.0 2 5.0 3 5.5 4 6.0 5 4.0 6 2.0 7 3.0 8 4.0 9 4.0 10 4.0 11 4.0 12 4.0 13 3.5 14 2.0 15 1.0 16 1.0 17 1.0 18 4.0 19 7.0 20 8.0 21 9.0 22 11.5 23 14.0 24 15.5 25 17.0 26 25.5 27 34.0 28 39.5 29 45.0 30 45.0 31 45.0 32 61.5 33 78.0 34 103.5 35 129.0 36 141.5 37 154.0 38 173.5 39 206.5 40 220.0 41 231.0 42 242.0 43 259.5 44 277.0 45 281.0 46 285.0 47 281.0 48 277.0 49 275.0 50 273.0 51 288.5 52 304.0 53 294.5 54 285.0 55 256.0 56 227.0 57 235.0 58 243.0 59 222.5 60 202.0 61 166.0 62 130.0 63 113.5 64 76.0 65 55.0 66 43.0 67 31.0 68 27.5 69 24.0 70 21.0 71 18.0 72 13.5 73 9.0 74 10.0 75 11.0 76 6.5 77 2.0 78 5.0 79 8.0 80 5.0 81 2.0 82 2.5 83 3.0 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.59899815449512 91.60000000000001 2 2.4255206960189826 4.6 3 0.5536514632217242 1.575 4 0.15818613234906406 0.6 5 0.21091484313208544 1.0 6 0.02636435539151068 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02636435539151068 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19 0.475 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCACTTTCGTGTACCCATCGGACGGCAGCCCTTTCGGGGGTTCCTTAGGGA 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit GGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTTGCAGCCAGAGCCACA 5 0.125 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 5 0.125 No Hit CTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAG 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra Read 200000 spots for SRR5423346.sra Written 200000 spots for SRR5423346.sra SRR ids: ['SRR5423346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ppxooxe7 SRR5423346.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423346 file size 704008 SRR5423346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423346 SRR5423346_1.fastq Input file: SRR5423346_1.fastq trimmed: SRR5423346-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 08:13:54 2025 >> started Wed Feb 12 08:13:56 2025 >> done (2.722s) 4000000 reads processed; of these: 129 ( 0.00%) short reads filtered out after trimming by size control 2835 ( 0.07%) empty reads filtered out after trimming by size control 3997036 (99.93%) reads available; of these: 99006 ( 2.48%) trimmed reads available after processing 3898030 (97.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 10 0.00% 21 5 0.00% 22 3 0.00% 23 6 0.00% 24 3 0.00% 25 7 0.00% 26 13 0.00% 27 12 0.00% 28 9 0.00% 29 11 0.00% 30 15 0.00% 31 25 0.00% 32 20 0.00% 33 47 0.00% 34 40 0.00% 35 63 0.00% 36 80 0.00% 37 92 0.00% 38 80 0.00% 39 114 0.00% 40 160 0.00% 41 208 0.01% 42 295 0.01% 43 321 0.01% 44 448 0.01% 45 666 0.02% 46 907 0.02% 47 1660 0.04% 48 2489 0.06% 49 4549 0.11% 50 12331 0.31% 51 74301 1.86% 52 3898030 97.52% 3997036 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=18 prefix-density=1.02 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=20.02 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 12 08:14:11 Started mapping on | Feb 12 08:14:11 Finished on | Feb 12 08:14:19 Mapping speed, Million of reads per hour | 1798.67 Number of input reads | 3997036 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3272397 Uniquely mapped reads % | 81.87% Average mapped length | 51.75 Number of splices: Total | 299339 Number of splices: Annotated (sjdb) | 293690 Number of splices: GT/AG | 291688 Number of splices: GC/AG | 5945 Number of splices: AT/AC | 479 Number of splices: Non-canonical | 1227 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429203 % of reads mapped to multiple loci | 10.74% Number of reads mapped to too many loci | 145151 % of reads mapped to too many loci | 3.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295436 295436 295436 N_multimapping 429203 429203 429203 N_noFeature 600998 3150084 714499 N_ambiguous 18141 146 9200 UnstrandedReadsAssigned:2653258 PositiveStrandReadsAssigned:122167 NegativeStrandReadsAssigned:2548698 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423346 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423346-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,036 reads, 2,834,906 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR5423346.ke.tsv 34699 SRR5423346.se.tsv 87100 total ==> SRR5423346.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 315 59.5213 Potri.005G024800.1.v4.1 1035 936 18 6.97322 Potri.004G059700.1.v4.1 961 862 3 1.26198 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 61.5464 7.84712 Potri.016G087400.1.v4.1 270 171 16 33.9282 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17.8524 3.86704 Potri.012G127500.1.v4.1 977 878 121 49.9721 ==> SRR5423346.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 50 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423346 completed mapping pipeline successfully