Starting /dee2/code/volunteer_pipeline.sh SRR5423347 current disk space = 3050512502784 free memory = 1579255512 SRR5423347 SRAfilesize 7ff421516246ff0c63d0829077d36139 SRR5423347.sra SRR5423347.sra file validated SRR5423347 is single end SRR5423347 is conventional basespace SRR5423347 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.99725 33.0 31.0 34.0 30.0 34.0 2 32.13625 34.0 31.0 34.0 30.0 34.0 3 32.11325 34.0 31.0 34.0 30.0 34.0 4 35.4215 37.0 35.0 37.0 33.0 37.0 5 35.57225 37.0 35.0 37.0 33.0 37.0 6 35.56725 37.0 35.0 37.0 33.0 37.0 7 35.694 37.0 35.0 37.0 33.0 37.0 8 35.7105 37.0 35.0 37.0 33.0 37.0 9 37.27875 39.0 37.0 39.0 34.0 39.0 10 37.251 39.0 37.0 39.0 33.0 39.0 11 37.217 39.0 37.0 39.0 33.0 39.0 12 37.2385 39.0 37.0 39.0 33.0 39.0 13 37.11425 39.0 37.0 39.0 33.0 39.0 14 38.41375 40.0 38.0 41.0 34.0 41.0 15 38.35175 40.0 38.0 41.0 33.0 41.0 16 38.26425 40.0 38.0 41.0 33.0 41.0 17 38.207 40.0 38.0 41.0 33.0 41.0 18 38.248 40.0 38.0 41.0 33.0 41.0 19 38.29575 40.0 38.0 41.0 33.0 41.0 20 38.3515 40.0 38.0 41.0 34.0 41.0 21 38.1805 40.0 37.0 41.0 33.0 41.0 22 38.00325 40.0 37.0 41.0 32.0 41.0 23 38.33325 40.0 38.0 41.0 34.0 41.0 24 38.15775 40.0 38.0 41.0 33.0 41.0 25 38.26025 40.0 38.0 41.0 34.0 41.0 26 38.138 40.0 38.0 41.0 33.0 41.0 27 38.108 40.0 37.0 41.0 33.0 41.0 28 38.03575 40.0 37.0 41.0 33.0 41.0 29 38.0695 40.0 38.0 41.0 33.0 41.0 30 37.96 40.0 37.0 41.0 33.0 41.0 31 37.85375 40.0 37.0 41.0 33.0 41.0 32 37.99275 40.0 37.0 41.0 33.0 41.0 33 37.9355 40.0 37.0 41.0 33.0 41.0 34 37.644 40.0 37.0 41.0 32.0 41.0 35 37.6 40.0 37.0 41.0 32.0 41.0 36 37.39925 40.0 36.0 41.0 31.0 41.0 37 37.589 40.0 37.0 41.0 32.0 41.0 38 37.6145 40.0 37.0 41.0 32.0 41.0 39 37.44675 40.0 37.0 41.0 32.0 41.0 40 37.334 40.0 36.0 41.0 31.0 41.0 41 37.27825 40.0 36.0 41.0 31.0 41.0 42 37.039 39.0 36.0 41.0 30.0 41.0 43 37.259 39.0 36.0 41.0 31.0 41.0 44 37.23375 39.0 36.0 41.0 31.0 41.0 45 37.144 39.0 35.0 41.0 31.0 41.0 46 36.80075 39.0 35.0 41.0 30.0 41.0 47 36.88425 39.0 35.0 41.0 30.0 41.0 48 36.79625 39.0 35.0 41.0 30.0 41.0 49 36.80975 39.0 35.0 41.0 30.0 41.0 50 36.63625 39.0 35.0 41.0 30.0 41.0 51 36.69975 39.0 35.0 40.0 30.0 41.0 52 35.5705 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1211 1 0.0 1211 2 0.0 1211 3 0.0 1211 4 0.0 1211 5 0.0 1211 6 0.0 1211 7 0.0 1211 8 0.0 1211 9 0.0 1211 10 0.0 1211 11 0.0 1211 12 0.0 1211 13 0.0 1211 14 0.0 1211 15 0.0 1211 16 0.0 1211 17 0.0 1211 18 0.0 1211 19 0.0 1211 20 0.0 1211 21 0.0 1211 22 0.0 1211 23 0.0 1211 24 0.0 1211 25 0.0 1211 26 0.0 1211 27 0.0 1211 28 0.0 1211 29 0.0 1211 30 0.0 1211 31 0.0 1211 32 0.0 1211 33 0.0 1211 34 0.0 1211 35 0.0 1211 36 0.0 1211 37 0.0 1211 38 0.0 1211 39 0.0 1211 40 0.0 1211 41 0.0 1211 42 0.0 1211 43 0.0 1211 44 0.0 1211 45 0.0 1211 46 0.0 1211 47 0.0 1211 48 0.0 1211 49 0.0 1211 50 0.0 1211 51 0.0 1211 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 2.0 22 5.0 23 4.0 24 9.0 25 12.0 26 17.0 27 27.0 28 29.0 29 56.0 30 58.0 31 100.0 32 108.0 33 153.0 34 206.0 35 283.0 36 309.0 37 452.0 38 714.0 39 1447.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.01954397394137 12.778752192432973 5.3871210223001755 39.81458281132548 2 21.05 15.049999999999999 35.0 28.9 3 19.775000000000002 19.025 24.45 36.75 4 24.075 26.525 22.175 27.224999999999998 5 23.05 32.300000000000004 23.925 20.724999999999998 6 20.4 33.85 23.3 22.45 7 15.425 24.625 39.975 19.975 8 17.325 23.425 30.9 28.349999999999998 9 18.0 21.349999999999998 34.675 25.974999999999998 10 18.475 36.5 24.825 20.200000000000003 11 22.375 27.900000000000002 22.6 27.125 12 21.175 25.374999999999996 27.075 26.375 13 20.05 27.425 26.924999999999997 25.6 14 20.95 28.9 25.724999999999998 24.425 15 20.9 26.875 26.025 26.200000000000003 16 20.775 26.974999999999998 25.974999999999998 26.275 17 21.85 26.474999999999998 26.35 25.324999999999996 18 20.75 28.4 23.799999999999997 27.05 19 21.675 27.500000000000004 25.424999999999997 25.4 20 21.6 26.700000000000003 27.6 24.099999999999998 21 21.775 26.200000000000003 25.474999999999998 26.55 22 19.625 28.95 25.575 25.85 23 21.75 27.250000000000004 25.424999999999997 25.575 24 20.925 26.700000000000003 26.400000000000002 25.974999999999998 25 22.35 26.924999999999997 24.975 25.75 26 21.2 27.6 25.324999999999996 25.874999999999996 27 20.9 27.1 25.8 26.200000000000003 28 20.575 27.625 26.950000000000003 24.85 29 21.3 27.1 26.174999999999997 25.424999999999997 30 22.05 26.025 25.775 26.150000000000002 31 22.85 27.200000000000003 26.075 23.875 32 23.275000000000002 26.75 25.35 24.625 33 23.225 26.974999999999998 24.725 25.074999999999996 34 21.8 27.150000000000002 26.525 24.525 35 22.275 26.25 24.825 26.650000000000002 36 21.55 26.224999999999998 23.674999999999997 28.549999999999997 37 21.6 27.0 25.8 25.6 38 21.825 26.700000000000003 25.275 26.200000000000003 39 22.025 26.0 25.174999999999997 26.8 40 20.4 26.674999999999997 25.6 27.325 41 21.725 26.674999999999997 25.924999999999997 25.674999999999997 42 21.349999999999998 25.724999999999998 26.1 26.825 43 21.925 26.450000000000003 25.45 26.174999999999997 44 21.575 26.625 25.7 26.1 45 21.325 26.625 25.15 26.900000000000002 46 20.775 26.525 26.224999999999998 26.474999999999998 47 21.65 26.150000000000002 26.275 25.924999999999997 48 20.925 26.724999999999998 25.825 26.525 49 21.65 25.924999999999997 24.725 27.700000000000003 50 20.674999999999997 27.450000000000003 25.0 26.875 51 21.425 26.224999999999998 24.975 27.375 52 22.45 27.700000000000003 23.7 26.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 25.0 1 15.5 2 6.0 3 7.0 4 8.0 5 5.0 6 2.0 7 2.5 8 3.0 9 3.5 10 4.0 11 3.5 12 3.0 13 2.5 14 2.0 15 2.0 16 4.5 17 7.0 18 5.0 19 3.0 20 7.0 21 11.0 22 11.5 23 12.0 24 14.0 25 16.0 26 21.0 27 26.0 28 30.5 29 35.0 30 49.5 31 64.0 32 79.5 33 95.0 34 111.5 35 128.0 36 149.5 37 171.0 38 173.5 39 201.5 40 227.0 41 225.5 42 224.0 43 246.0 44 268.0 45 278.0 46 288.0 47 280.0 48 272.0 49 274.0 50 276.0 51 289.0 52 302.0 53 301.5 54 301.0 55 263.5 56 226.0 57 224.0 58 222.0 59 197.5 60 173.0 61 164.0 62 155.0 63 124.0 64 76.0 65 59.0 66 49.0 67 39.0 68 30.0 69 21.0 70 20.5 71 20.0 72 17.5 73 15.0 74 8.5 75 2.0 76 4.0 77 6.0 78 6.5 79 7.0 80 5.0 81 3.0 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.67194928684627 91.5 2 2.324352879027998 4.3999999999999995 3 0.5810882197569995 1.6500000000000001 4 0.21130480718436345 0.8 5 0.15847860538827258 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05282620179609086 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 25 0.625 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 11 0.27499999999999997 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit CAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCCCT 5 0.125 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra Read 200000 spots for SRR5423347.sra Written 200000 spots for SRR5423347.sra SRR ids: ['SRR5423347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a9c4kcbd SRR5423347.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423347 file size 703960 SRR5423347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423347 SRR5423347_1.fastq Input file: SRR5423347_1.fastq trimmed: SRR5423347-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:18:34 2025 >> started Wed Feb 12 23:23:12 2025 >> done (278.211s) 4000000 reads processed; of these: 152 ( 0.00%) short reads filtered out after trimming by size control 3051 ( 0.08%) empty reads filtered out after trimming by size control 3996797 (99.92%) reads available; of these: 80783 ( 2.02%) trimmed reads available after processing 3916014 (97.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 10 0.00% 20 8 0.00% 21 6 0.00% 22 4 0.00% 23 3 0.00% 24 7 0.00% 25 7 0.00% 26 9 0.00% 27 10 0.00% 28 14 0.00% 29 12 0.00% 30 13 0.00% 31 17 0.00% 32 16 0.00% 33 26 0.00% 34 41 0.00% 35 26 0.00% 36 52 0.00% 37 60 0.00% 38 74 0.00% 39 113 0.00% 40 130 0.00% 41 171 0.00% 42 201 0.01% 43 250 0.01% 44 345 0.01% 45 554 0.01% 46 743 0.02% 47 1128 0.03% 48 1822 0.05% 49 3520 0.09% 50 10056 0.25% 51 61322 1.53% 52 3916014 97.98% 3996797 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=20.11 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 12 23:30:28 Started mapping on | Feb 12 23:30:45 Finished on | Feb 13 00:17:53 Mapping speed, Million of reads per hour | 5.09 Number of input reads | 3996797 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3272743 Uniquely mapped reads % | 81.88% Average mapped length | 51.76 Number of splices: Total | 298281 Number of splices: Annotated (sjdb) | 292664 Number of splices: GT/AG | 290627 Number of splices: GC/AG | 5962 Number of splices: AT/AC | 442 Number of splices: Non-canonical | 1250 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428204 % of reads mapped to multiple loci | 10.71% Number of reads mapped to too many loci | 145739 % of reads mapped to too many loci | 3.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295850 295850 295850 N_multimapping 428204 428204 428204 N_noFeature 601312 3149960 715341 N_ambiguous 18014 122 9153 UnstrandedReadsAssigned:2653417 PositiveStrandReadsAssigned:122661 NegativeStrandReadsAssigned:2548249 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423347 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423347-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,996,797 reads, 2,856,875 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR5423347.ke.tsv 34699 SRR5423347.se.tsv 87100 total ==> SRR5423347.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 312 58.5365 Potri.005G024800.1.v4.1 1035 936 24 9.23171 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 50.0595 6.3373 Potri.016G087400.1.v4.1 270 171 16 33.6877 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22 4.73167 Potri.012G127500.1.v4.1 977 878 152 62.3298 ==> SRR5423347.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423347 completed mapping pipeline successfully