Starting /dee2/code/volunteer_pipeline.sh SRR5423348 current disk space = 3050490339328 free memory = 1579817048 SRR5423348 SRAfilesize 3405ccfc42063a5310d224451c0126aa SRR5423348.sra SRR5423348.sra file validated SRR5423348 is single end SRR5423348 is conventional basespace SRR5423348 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2005 34.0 31.0 34.0 30.0 34.0 2 32.31875 34.0 31.0 34.0 30.0 34.0 3 32.398 34.0 31.0 34.0 30.0 34.0 4 35.835 37.0 35.0 37.0 35.0 37.0 5 35.88275 37.0 35.0 37.0 35.0 37.0 6 35.88875 37.0 35.0 37.0 35.0 37.0 7 35.81225 37.0 35.0 37.0 35.0 37.0 8 35.84675 37.0 35.0 37.0 35.0 37.0 9 37.566 39.0 37.0 39.0 35.0 39.0 10 37.32875 39.0 37.0 39.0 34.0 39.0 11 37.52375 39.0 37.0 39.0 35.0 39.0 12 37.47025 39.0 37.0 39.0 35.0 39.0 13 37.34975 39.0 37.0 39.0 34.0 39.0 14 38.747 40.0 38.0 41.0 34.0 41.0 15 38.81125 40.0 38.0 41.0 35.0 41.0 16 38.68975 40.0 38.0 41.0 34.0 41.0 17 38.617 40.0 38.0 41.0 34.0 41.0 18 38.58725 40.0 38.0 41.0 34.0 41.0 19 38.55725 40.0 38.0 41.0 34.0 41.0 20 38.57825 40.0 38.0 41.0 34.0 41.0 21 38.66825 40.0 38.0 41.0 34.0 41.0 22 38.65925 40.0 38.0 41.0 34.0 41.0 23 38.4495 40.0 38.0 41.0 34.0 41.0 24 38.5375 40.0 38.0 41.0 34.0 41.0 25 38.41875 40.0 38.0 41.0 34.0 41.0 26 38.37175 40.0 38.0 41.0 34.0 41.0 27 38.1155 40.0 38.0 41.0 33.0 41.0 28 38.1145 40.0 38.0 41.0 33.0 41.0 29 38.232 40.0 38.0 41.0 34.0 41.0 30 38.27275 40.0 38.0 41.0 34.0 41.0 31 38.219 40.0 38.0 41.0 33.0 41.0 32 38.10725 40.0 38.0 41.0 33.0 41.0 33 38.16425 40.0 38.0 41.0 33.0 41.0 34 38.084 40.0 38.0 41.0 33.0 41.0 35 37.86425 40.0 37.0 41.0 33.0 41.0 36 37.902 40.0 37.0 41.0 33.0 41.0 37 37.9995 40.0 37.0 41.0 33.0 41.0 38 37.75075 40.0 37.0 41.0 33.0 41.0 39 37.76825 40.0 37.0 41.0 32.0 41.0 40 37.6285 40.0 37.0 41.0 32.0 41.0 41 37.29925 40.0 36.0 41.0 31.0 41.0 42 37.292 40.0 36.0 41.0 31.0 41.0 43 37.29775 40.0 36.0 41.0 31.0 41.0 44 37.40525 40.0 36.0 41.0 31.0 41.0 45 37.065 40.0 36.0 41.0 31.0 41.0 46 37.2805 40.0 36.0 41.0 31.0 41.0 47 37.21075 40.0 36.0 41.0 31.0 41.0 48 36.98225 39.0 35.0 41.0 31.0 41.0 49 36.84175 39.0 35.0 41.0 30.0 41.0 50 37.0205 39.0 35.0 41.0 31.0 41.0 51 36.91525 39.0 35.0 41.0 31.0 41.0 52 35.8215 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1308 1 0.0 1308 2 0.0 1308 3 0.0 1308 4 0.0 1308 5 0.0 1308 6 0.0 1308 7 0.0 1308 8 0.0 1308 9 0.0 1308 10 0.0 1308 11 0.0 1308 12 0.0 1308 13 0.0 1308 14 0.0 1308 15 0.0 1308 16 0.0 1308 17 0.0 1308 18 0.0 1308 19 0.0 1308 20 0.0 1308 21 0.0 1308 22 0.0 1308 23 0.0 1308 24 0.0 1308 25 0.0 1308 26 0.0 1308 27 0.0 1308 28 0.0 1308 29 0.0 1308 30 0.0 1308 31 0.0 1308 32 0.0 1308 33 0.0 1308 34 0.0 1308 35 0.0 1308 36 0.0 1308 37 0.0 1308 38 0.0 1308 39 0.0 1308 40 0.0 1308 41 0.0 1308 42 0.0 1308 43 0.0 1308 44 0.0 1308 45 0.0 1308 46 0.0 1308 47 0.0 1308 48 0.0 1308 49 0.0 1308 50 0.0 1308 51 0.0 1308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 2.0 23 7.0 24 10.0 25 11.0 26 10.0 27 21.0 28 33.0 29 44.0 30 77.0 31 75.0 32 93.0 33 110.0 34 161.0 35 245.0 36 293.0 37 453.0 38 721.0 39 1617.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.77485599799649 12.722263961933383 5.234159779614325 39.268720260455794 2 21.25 14.649999999999999 35.25 28.849999999999998 3 19.45 18.8 25.424999999999997 36.325 4 23.05 26.450000000000003 22.2 28.299999999999997 5 24.825 31.25 23.9 20.025000000000002 6 20.225 34.475 22.85 22.45 7 15.45 24.575 40.675 19.3 8 16.775000000000002 24.25 30.75 28.225 9 17.7 21.85 33.825 26.625 10 20.200000000000003 36.95 23.200000000000003 19.650000000000002 11 23.125 27.425 22.7 26.75 12 22.1 24.75 27.474999999999998 25.674999999999997 13 19.650000000000002 28.799999999999997 26.674999999999997 24.875 14 19.55 27.400000000000002 26.400000000000002 26.650000000000002 15 21.475 26.150000000000002 26.275 26.1 16 21.65 25.650000000000002 25.874999999999996 26.825 17 23.325000000000003 25.4 25.624999999999996 25.650000000000002 18 20.95 26.275 26.474999999999998 26.3 19 21.175 26.075 26.450000000000003 26.3 20 21.6 25.825 27.725 24.85 21 20.985492746373186 25.76288144072036 26.3631815907954 26.88844422211106 22 20.549999999999997 27.474999999999998 26.35 25.624999999999996 23 21.45 27.825 25.45 25.275 24 21.95 26.325 26.400000000000002 25.324999999999996 25 21.925 26.375 25.6 26.1 26 22.400000000000002 25.874999999999996 25.825 25.900000000000002 27 21.3 26.700000000000003 25.85 26.150000000000002 28 22.075 27.425 26.825 23.674999999999997 29 22.075 25.874999999999996 27.200000000000003 24.85 30 21.575 25.424999999999997 26.8 26.200000000000003 31 21.95 26.075 25.650000000000002 26.325 32 21.05 27.400000000000002 25.25 26.3 33 20.8 26.025 26.174999999999997 27.0 34 21.9 25.924999999999997 25.45 26.724999999999998 35 20.4 25.650000000000002 26.35 27.6 36 19.8 26.875 25.775 27.55 37 22.425 24.675 25.15 27.750000000000004 38 22.125 26.900000000000002 25.05 25.924999999999997 39 21.575 25.775 25.575 27.075 40 21.0 28.325 25.424999999999997 25.25 41 21.5 26.224999999999998 27.500000000000004 24.775 42 22.15 25.074999999999996 25.474999999999998 27.3 43 21.875 26.875 25.35 25.900000000000002 44 21.3 26.125 26.924999999999997 25.650000000000002 45 20.974999999999998 27.075 25.825 26.125 46 22.25 26.400000000000002 24.3 27.05 47 22.95 25.874999999999996 25.724999999999998 25.45 48 22.35 25.874999999999996 24.775 27.0 49 21.48574287143572 25.887943971985994 26.23811905952976 26.388194097048522 50 22.786393196598297 26.488244122061033 25.03751875937969 25.68784392196098 51 20.375 26.85 25.35 27.425 52 23.599999999999998 25.7 24.6 26.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 18.0 1 12.0 2 6.0 3 6.0 4 6.0 5 6.5 6 7.0 7 6.5 8 6.0 9 4.5 10 3.0 11 2.0 12 1.0 13 0.5 14 0.0 15 0.0 16 1.5 17 3.0 18 5.0 19 7.0 20 5.5 21 4.0 22 9.0 23 14.0 24 14.5 25 15.0 26 23.5 27 32.0 28 35.5 29 39.0 30 46.5 31 54.0 32 63.5 33 73.0 34 106.0 35 139.0 36 144.0 37 149.0 38 170.0 39 211.0 40 231.0 41 247.0 42 263.0 43 261.0 44 259.0 45 262.0 46 265.0 47 286.5 48 308.0 49 291.5 50 275.0 51 284.5 52 294.0 53 287.5 54 281.0 55 258.5 56 236.0 57 217.5 58 199.0 59 197.5 60 196.0 61 170.0 62 144.0 63 115.0 64 84.5 65 83.0 66 58.5 67 34.0 68 24.0 69 14.0 70 20.0 71 26.0 72 20.0 73 14.0 74 12.0 75 10.0 76 7.5 77 5.0 78 3.5 79 2.0 80 3.5 81 5.0 82 2.5 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.05 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.05 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.8633573525487 89.8 2 2.8823058446757406 5.4 3 0.8006405124099278 2.25 4 0.16012810248198558 0.6 5 0.16012810248198558 0.75 6 0.02668801708033093 0.15 7 0.02668801708033093 0.17500000000000002 8 0.02668801708033093 0.2 9 0.02668801708033093 0.22499999999999998 >10 0.02668801708033093 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 18 0.44999999999999996 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 9 0.22499999999999998 No Hit CTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCATGTA 8 0.2 No Hit CAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATTGA 7 0.17500000000000002 No Hit GTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCG 6 0.15 No Hit GTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAG 5 0.125 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit CTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAG 5 0.125 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra Read 200000 spots for SRR5423348.sra Written 200000 spots for SRR5423348.sra SRR ids: ['SRR5423348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f31vrf72 SRR5423348.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423348 file size 703964 SRR5423348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423348 SRR5423348_1.fastq Input file: SRR5423348_1.fastq trimmed: SRR5423348-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:19:29 2025 >> started Wed Feb 12 23:21:19 2025 >> done (110.269s) 4000000 reads processed; of these: 137 ( 0.00%) short reads filtered out after trimming by size control 3016 ( 0.08%) empty reads filtered out after trimming by size control 3996847 (99.92%) reads available; of these: 85188 ( 2.13%) trimmed reads available after processing 3911659 (97.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 0 0.00% 23 5 0.00% 24 9 0.00% 25 5 0.00% 26 13 0.00% 27 7 0.00% 28 8 0.00% 29 16 0.00% 30 14 0.00% 31 17 0.00% 32 29 0.00% 33 26 0.00% 34 37 0.00% 35 41 0.00% 36 43 0.00% 37 50 0.00% 38 65 0.00% 39 101 0.00% 40 105 0.00% 41 135 0.00% 42 181 0.00% 43 234 0.01% 44 360 0.01% 45 525 0.01% 46 675 0.02% 47 1178 0.03% 48 1802 0.05% 49 3766 0.09% 50 10550 0.26% 51 65165 1.63% 52 3911659 97.87% 3996847 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=1.04 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=19.19 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 12 23:24:52 Started mapping on | Feb 12 23:25:13 Finished on | Feb 12 23:35:33 Mapping speed, Million of reads per hour | 23.21 Number of input reads | 3996847 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3272500 Uniquely mapped reads % | 81.88% Average mapped length | 51.76 Number of splices: Total | 299217 Number of splices: Annotated (sjdb) | 293502 Number of splices: GT/AG | 291570 Number of splices: GC/AG | 5928 Number of splices: AT/AC | 436 Number of splices: Non-canonical | 1283 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428383 % of reads mapped to multiple loci | 10.72% Number of reads mapped to too many loci | 145664 % of reads mapped to too many loci | 3.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295964 295964 295964 N_multimapping 428383 428383 428383 N_noFeature 601182 3150797 714143 N_ambiguous 17923 148 9048 UnstrandedReadsAssigned:2653395 PositiveStrandReadsAssigned:121555 NegativeStrandReadsAssigned:2549309 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423348 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423348-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,996,847 reads, 2,855,664 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR5423348.ke.tsv 34699 SRR5423348.se.tsv 87100 total ==> SRR5423348.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 331 62.1245 Potri.005G024800.1.v4.1 1035 936 21 8.08079 Potri.004G059700.1.v4.1 961 862 2 0.835666 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 67.7032 8.57412 Potri.016G087400.1.v4.1 270 171 15 31.5941 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.7068 3.59457 Potri.012G127500.1.v4.1 977 878 134 54.9693 ==> SRR5423348.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423348 completed mapping pipeline successfully