Starting /dee2/code/volunteer_pipeline.sh SRR5423349 current disk space = 3050515832832 free memory = 1579271284 SRR5423349 SRAfilesize 60e6043bcdcfcfe14097cf850b56fdb3 SRR5423349.sra SRR5423349.sra file validated SRR5423349 is single end SRR5423349 is conventional basespace SRR5423349 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42525 34.0 31.0 34.0 30.0 34.0 2 32.5355 34.0 31.0 34.0 31.0 34.0 3 32.532 34.0 31.0 34.0 30.0 34.0 4 35.893 37.0 35.0 37.0 35.0 37.0 5 35.93525 37.0 35.0 37.0 35.0 37.0 6 35.8945 37.0 35.0 37.0 35.0 37.0 7 35.93525 37.0 35.0 37.0 35.0 37.0 8 35.8635 37.0 35.0 37.0 35.0 37.0 9 37.59175 39.0 37.0 39.0 35.0 39.0 10 37.37725 39.0 37.0 39.0 34.0 39.0 11 37.43125 39.0 37.0 39.0 34.0 39.0 12 37.4395 39.0 37.0 39.0 34.0 39.0 13 37.44225 39.0 37.0 39.0 35.0 39.0 14 38.77425 40.0 38.0 41.0 35.0 41.0 15 38.85 40.0 38.0 41.0 35.0 41.0 16 38.8455 40.0 38.0 41.0 35.0 41.0 17 38.74425 40.0 38.0 41.0 35.0 41.0 18 38.64925 40.0 38.0 41.0 34.0 41.0 19 38.684 40.0 38.0 41.0 34.0 41.0 20 38.7315 40.0 38.0 41.0 34.0 41.0 21 38.77475 40.0 38.0 41.0 35.0 41.0 22 38.741 40.0 38.0 41.0 35.0 41.0 23 38.594 40.0 38.0 41.0 34.0 41.0 24 38.66475 40.0 38.0 41.0 34.0 41.0 25 38.63 40.0 38.0 41.0 34.0 41.0 26 38.34275 40.0 38.0 41.0 34.0 41.0 27 38.42425 40.0 38.0 41.0 34.0 41.0 28 38.52275 40.0 38.0 41.0 34.0 41.0 29 38.3835 40.0 38.0 41.0 34.0 41.0 30 38.30525 40.0 38.0 41.0 34.0 41.0 31 38.2055 40.0 38.0 41.0 33.0 41.0 32 38.2565 40.0 38.0 41.0 33.0 41.0 33 38.189 40.0 38.0 41.0 33.0 41.0 34 38.095 40.0 38.0 41.0 33.0 41.0 35 37.98575 40.0 38.0 41.0 33.0 41.0 36 37.96375 40.0 38.0 41.0 33.0 41.0 37 37.83575 40.0 37.0 41.0 33.0 41.0 38 37.829 40.0 37.0 41.0 33.0 41.0 39 37.642 40.0 37.0 41.0 31.0 41.0 40 37.541 40.0 37.0 41.0 31.0 41.0 41 37.656 40.0 37.0 41.0 32.0 41.0 42 37.54375 40.0 37.0 41.0 32.0 41.0 43 37.5405 40.0 37.0 41.0 32.0 41.0 44 37.42075 40.0 37.0 41.0 31.0 41.0 45 37.2185 40.0 36.0 41.0 31.0 41.0 46 37.17125 40.0 36.0 41.0 30.0 41.0 47 37.0095 40.0 36.0 41.0 31.0 41.0 48 36.87175 39.0 35.0 41.0 30.0 41.0 49 36.941 39.0 36.0 41.0 31.0 41.0 50 36.78625 39.0 35.0 41.0 30.0 41.0 51 36.567 39.0 35.0 41.0 30.0 41.0 52 35.2605 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2104 1 0.0 2104 2 0.0 2104 3 0.0 2104 4 0.0 2104 5 0.0 2104 6 0.0 2104 7 0.0 2104 8 0.0 2104 9 0.0 2104 10 0.0 2104 11 0.0 2104 12 0.0 2104 13 0.0 2104 14 0.0 2104 15 0.0 2104 16 0.0 2104 17 0.0 2104 18 0.0 2104 19 0.0 2104 20 0.0 2104 21 0.0 2104 22 0.0 2104 23 0.0 2104 24 0.0 2104 25 0.0 2104 26 0.0 2104 27 0.0 2104 28 0.0 2104 29 0.0 2104 30 0.0 2104 31 0.0 2104 32 0.0 2104 33 0.0 2104 34 0.0 2104 35 0.0 2104 36 0.0 2104 37 0.0 2104 38 0.0 2104 39 0.0 2104 40 0.0 2104 41 0.0 2104 42 0.0 2104 43 0.0 2104 44 0.0 2104 45 0.0 2104 46 0.0 2104 47 0.0 2104 48 0.0 2104 49 0.0 2104 50 0.0 2104 51 0.0 2104 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.0 18 0.0 19 0.0 20 2.0 21 0.0 22 2.0 23 7.0 24 12.0 25 11.0 26 13.0 27 17.0 28 37.0 29 39.0 30 59.0 31 77.0 32 101.0 33 135.0 34 142.0 35 185.0 36 291.0 37 431.0 38 721.0 39 1703.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.57822277847309 12.916145181476846 5.281602002503129 39.22403003754694 2 20.424999999999997 14.299999999999999 34.925 30.349999999999998 3 20.200000000000003 17.95 25.474999999999998 36.375 4 24.4 27.650000000000002 21.9 26.05 5 24.8 32.775 21.099999999999998 21.325 6 20.275000000000002 35.5 21.85 22.375 7 15.625 25.8 40.425 18.15 8 17.4 23.474999999999998 29.975 29.15 9 18.3 21.55 33.1 27.05 10 18.85 37.425000000000004 23.625 20.1 11 22.275 29.175 21.6 26.950000000000003 12 20.8 25.474999999999998 26.55 27.175 13 20.05 27.375 27.525 25.05 14 20.625 27.825 26.6 24.95 15 21.675 26.3 26.325 25.7 16 21.175 26.474999999999998 26.325 26.025 17 20.65 26.625 25.8 26.924999999999997 18 20.7 27.425 25.900000000000002 25.974999999999998 19 22.3 27.425 25.8 24.474999999999998 20 22.025 25.825 27.250000000000004 24.9 21 20.75 28.000000000000004 25.35 25.900000000000002 22 22.675 26.825 25.575 24.925 23 21.025 27.325 25.55 26.1 24 22.6 25.825 25.924999999999997 25.650000000000002 25 22.3 26.700000000000003 24.075 26.924999999999997 26 21.7 26.25 25.974999999999998 26.075 27 20.9 27.85 25.05 26.200000000000003 28 22.625 26.8 25.3 25.275 29 21.05 27.025 26.075 25.85 30 21.275 26.474999999999998 24.975 27.275 31 21.175 27.85 25.3 25.674999999999997 32 22.625 26.075 25.474999999999998 25.825 33 22.5 25.25 26.75 25.5 34 22.05 27.0 25.0 25.95 35 22.125 25.25 25.724999999999998 26.900000000000002 36 20.875 26.775 25.624999999999996 26.724999999999998 37 21.75 26.6 24.85 26.8 38 21.2 26.224999999999998 26.200000000000003 26.375 39 22.25 25.074999999999996 25.825 26.85 40 20.7 27.0 26.525 25.775 41 21.825 26.05 26.775 25.35 42 21.6 25.124999999999996 27.275 26.0 43 21.8 27.325 24.975 25.900000000000002 44 20.474999999999998 27.1 26.325 26.1 45 21.224999999999998 26.1 26.325 26.35 46 21.85 26.3 24.9 26.950000000000003 47 22.5 26.474999999999998 24.5 26.525 48 21.224999999999998 27.575 24.375 26.825 49 22.675 27.375 24.375 25.575 50 22.1 26.424999999999997 24.975 26.5 51 20.775 26.400000000000002 25.374999999999996 27.450000000000003 52 22.900000000000002 27.0 23.575 26.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 14.0 1 10.0 2 6.0 3 4.0 4 2.0 5 2.5 6 3.0 7 2.0 8 1.0 9 2.5 10 4.0 11 2.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.0 17 3.0 18 2.5 19 2.0 20 7.5 21 13.0 22 13.5 23 14.0 24 18.5 25 23.0 26 26.0 27 29.0 28 35.0 29 41.0 30 46.5 31 52.0 32 61.5 33 71.0 34 94.5 35 118.0 36 142.0 37 166.0 38 178.0 39 205.5 40 221.0 41 243.0 42 265.0 43 266.5 44 268.0 45 268.0 46 268.0 47 272.0 48 276.0 49 310.5 50 345.0 51 314.5 52 284.0 53 298.0 54 312.0 55 273.0 56 234.0 57 217.5 58 201.0 59 181.0 60 161.0 61 150.5 62 140.0 63 116.0 64 80.5 65 69.0 66 55.0 67 41.0 68 34.5 69 28.0 70 20.0 71 12.0 72 13.0 73 14.0 74 9.5 75 5.0 76 6.0 77 7.0 78 5.0 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.81913774973711 92.07499999999999 2 2.2082018927444795 4.2 3 0.6309148264984227 1.7999999999999998 4 0.13144058885383808 0.5 5 0.13144058885383808 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026288117770767613 0.22499999999999998 >10 0.052576235541535225 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 10 0.25 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 9 0.22499999999999998 No Hit GTCCCTCATTACGAGCTTGTACACATGCTTCTAGAGCTACTCGATTAGCAAC 5 0.125 No Hit GGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTTGCAGCCAGAGCCACA 5 0.125 No Hit CAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGGT 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit CTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra Read 200000 spots for SRR5423349.sra Written 200000 spots for SRR5423349.sra SRR ids: ['SRR5423349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u7n4im1u SRR5423349.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423349 file size 704002 SRR5423349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423349 SRR5423349_1.fastq Input file: SRR5423349_1.fastq trimmed: SRR5423349-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:18:27 2025 >> started Wed Feb 12 23:22:30 2025 >> done (243.507s) 4000000 reads processed; of these: 128 ( 0.00%) short reads filtered out after trimming by size control 2781 ( 0.07%) empty reads filtered out after trimming by size control 3997091 (99.93%) reads available; of these: 79722 ( 1.99%) trimmed reads available after processing 3917369 (98.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 4 0.00% 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 6 0.00% 28 7 0.00% 29 6 0.00% 30 12 0.00% 31 18 0.00% 32 18 0.00% 33 35 0.00% 34 21 0.00% 35 24 0.00% 36 41 0.00% 37 42 0.00% 38 60 0.00% 39 76 0.00% 40 87 0.00% 41 124 0.00% 42 148 0.00% 43 215 0.01% 44 330 0.01% 45 470 0.01% 46 631 0.02% 47 970 0.02% 48 1679 0.04% 49 3471 0.09% 50 9559 0.24% 51 61637 1.54% 52 3917369 98.01% 3997091 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=22 prefix-density=1.03 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=19.82 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGA Started job on | Feb 12 23:24:37 Started mapping on | Feb 12 23:24:45 Finished on | Feb 12 23:33:46 Mapping speed, Million of reads per hour | 26.60 Number of input reads | 3997091 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3273254 Uniquely mapped reads % | 81.89% Average mapped length | 51.75 Number of splices: Total | 298509 Number of splices: Annotated (sjdb) | 292811 Number of splices: GT/AG | 290822 Number of splices: GC/AG | 5945 Number of splices: AT/AC | 470 Number of splices: Non-canonical | 1272 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430444 % of reads mapped to multiple loci | 10.77% Number of reads mapped to too many loci | 142550 % of reads mapped to too many loci | 3.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293393 293393 293393 N_multimapping 430444 430444 430444 N_noFeature 602817 3151804 715364 N_ambiguous 18092 114 9093 UnstrandedReadsAssigned:2652345 PositiveStrandReadsAssigned:121336 NegativeStrandReadsAssigned:2548797 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423349 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423349-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,091 reads, 2,844,821 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR5423349.ke.tsv 34699 SRR5423349.se.tsv 87100 total ==> SRR5423349.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 297 56.0676 Potri.005G024800.1.v4.1 1035 936 30 11.6112 Potri.004G059700.1.v4.1 961 862 1 0.420265 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 61.2826 7.80617 Potri.016G087400.1.v4.1 270 171 16 33.8965 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17.7425 3.83964 Potri.012G127500.1.v4.1 977 878 142 58.5901 ==> SRR5423349.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 57 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423349 completed mapping pipeline successfully