Starting /dee2/code/volunteer_pipeline.sh SRR5423350 current disk space = 3050505306112 free memory = 1579923116 SRR5423350 SRAfilesize cdc5b385b6b5dd24ec69db276a14cc5d SRR5423350.sra SRR5423350.sra file validated SRR5423350 is single end SRR5423350 is conventional basespace SRR5423350 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423350_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2485 31.0 31.0 34.0 30.0 34.0 2 31.49625 31.0 31.0 34.0 30.0 34.0 3 31.54225 31.0 31.0 34.0 28.0 34.0 4 34.985 37.0 35.0 37.0 32.0 37.0 5 35.06575 37.0 35.0 37.0 32.0 37.0 6 35.1025 37.0 35.0 37.0 32.0 37.0 7 35.02125 36.0 35.0 37.0 32.0 37.0 8 34.89725 36.0 35.0 37.0 32.0 37.0 9 36.29675 38.0 35.0 39.0 32.0 39.0 10 35.9725 38.0 35.0 39.0 30.0 39.0 11 36.382 38.0 35.0 39.0 32.0 39.0 12 36.33575 38.0 35.0 39.0 32.0 39.0 13 36.23175 38.0 35.0 39.0 32.0 39.0 14 37.30575 39.0 36.0 41.0 32.0 41.0 15 36.7175 39.0 36.0 40.0 30.0 41.0 16 37.41725 39.0 36.0 41.0 32.0 41.0 17 37.15275 39.0 36.0 40.0 31.0 41.0 18 37.4225 39.0 36.0 41.0 32.0 41.0 19 37.397 39.0 36.0 41.0 32.0 41.0 20 37.50525 39.0 36.0 41.0 32.0 41.0 21 37.41325 39.0 36.0 41.0 32.0 41.0 22 37.42125 39.0 36.0 40.0 32.0 41.0 23 37.59 39.0 36.0 41.0 32.0 41.0 24 37.614 39.0 36.0 41.0 32.0 41.0 25 37.41275 39.0 36.0 41.0 32.0 41.0 26 31.1845 37.0 23.0 40.0 10.0 41.0 27 33.484 37.0 29.0 40.0 18.0 41.0 28 35.30375 37.0 33.0 40.0 27.0 41.0 29 36.299 38.0 35.0 40.0 30.0 41.0 30 36.45825 38.0 35.0 40.0 30.0 41.0 31 36.798 39.0 35.0 40.0 30.0 41.0 32 36.64025 39.0 35.0 40.0 30.0 41.0 33 36.739 39.0 35.0 40.0 30.0 41.0 34 36.97075 39.0 36.0 40.0 30.0 41.0 35 36.71925 39.0 35.0 40.0 30.0 41.0 36 36.703 39.0 35.0 40.0 30.0 41.0 37 36.735 39.0 35.0 40.0 30.0 41.0 38 36.74625 39.0 35.0 40.0 30.0 41.0 39 36.58125 39.0 35.0 40.0 30.0 41.0 40 36.5995 39.0 35.0 40.0 30.0 41.0 41 36.4375 38.0 35.0 40.0 30.0 41.0 42 36.47375 38.0 35.0 40.0 30.0 41.0 43 36.4665 39.0 35.0 40.0 30.0 41.0 44 36.1635 38.0 35.0 40.0 29.0 41.0 45 36.07475 38.0 34.0 40.0 28.0 41.0 46 35.957 38.0 34.0 40.0 28.0 41.0 47 35.88375 38.0 34.0 40.0 28.0 41.0 48 35.8275 38.0 34.0 40.0 28.0 41.0 49 35.86275 38.0 34.0 40.0 28.0 41.0 50 35.56675 38.0 34.0 40.0 27.0 41.0 51 35.668 38.0 34.0 40.0 28.0 41.0 52 35.51975 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2116 1 0.0 2116 2 0.0 2116 3 0.0 2116 4 0.0 2116 5 0.0 2116 6 0.0 2116 7 0.0 2116 8 0.0 2116 9 0.0 2116 10 0.0 2116 11 0.0 2116 12 0.0 2116 13 0.0 2116 14 0.0 2116 15 0.0 2116 16 0.0 2116 17 0.0 2116 18 0.0 2116 19 0.0 2116 20 0.0 2116 21 0.0 2116 22 0.0 2116 23 0.0 2116 24 0.0 2116 25 0.0 2116 26 0.0 2116 27 0.0 2116 28 0.0 2116 29 0.0 2116 30 0.0 2116 31 0.0 2116 32 0.0 2116 33 0.0 2116 34 0.0 2116 35 0.0 2116 36 0.0 2116 37 0.0 2116 38 0.0 2116 39 0.0 2116 40 0.0 2116 41 0.0 2116 42 0.0 2116 43 0.0 2116 44 0.0 2116 45 0.0 2116 46 0.0 2116 47 0.0 2116 48 0.0 2116 49 0.0 2116 50 0.0 2116 51 0.0 2116 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 5.0 23 12.0 24 12.0 25 20.0 26 28.0 27 44.0 28 65.0 29 78.0 30 104.0 31 153.0 32 200.0 33 227.0 34 253.0 35 380.0 36 426.0 37 559.0 38 790.0 39 639.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.102628285356694 13.266583229036296 5.456821026282854 39.17396745932415 2 21.0 14.725 35.275 28.999999999999996 3 20.474999999999998 18.8 25.25 35.475 4 22.725 26.224999999999998 23.474999999999998 27.575 5 24.2 32.275 23.325000000000003 20.200000000000003 6 19.025 34.075 23.9 23.0 7 14.575 24.675 42.125 18.625 8 17.125 23.175 30.25 29.45 9 18.375 22.875 33.5 25.25 10 18.975 35.5 26.1 19.425 11 22.35 27.900000000000002 22.5 27.250000000000004 12 21.075 24.925 27.150000000000002 26.85 13 18.8 29.325000000000003 26.900000000000002 24.975 14 20.225 29.175 26.724999999999998 23.875 15 21.65 27.400000000000002 27.474999999999998 23.474999999999998 16 21.425 26.625 25.900000000000002 26.05 17 22.85 26.474999999999998 25.3 25.374999999999996 18 19.900000000000002 27.625 26.5 25.974999999999998 19 21.325 27.075 25.0 26.6 20 20.825 26.575 27.1 25.5 21 20.674999999999997 27.975 25.35 26.0 22 20.849999999999998 28.449999999999996 25.775 24.925 23 21.2 27.55 25.624999999999996 25.624999999999996 24 21.675 26.025 26.525 25.775 25 22.1 27.05 24.675 26.174999999999997 26 27.750000000000004 24.55 24.95 22.75 27 22.1 26.125 25.275 26.5 28 20.775 28.425 25.974999999999998 24.825 29 21.224999999999998 27.950000000000003 25.575 25.25 30 22.025 26.625 25.3 26.05 31 21.975 26.85 25.55 25.624999999999996 32 22.7 26.924999999999997 25.624999999999996 24.75 33 21.8 25.6 26.075 26.525 34 21.425 26.875 26.424999999999997 25.275 35 20.95 25.974999999999998 26.825 26.25 36 21.25 27.200000000000003 24.75 26.8 37 21.625 27.3 24.8 26.275 38 20.575 27.425 25.674999999999997 26.325 39 20.25 27.250000000000004 25.724999999999998 26.775 40 21.375 27.150000000000002 26.375 25.1 41 22.0 25.8 26.05 26.150000000000002 42 20.8 27.400000000000002 26.150000000000002 25.650000000000002 43 21.25 28.15 24.275 26.325 44 21.2 27.725 25.674999999999997 25.4 45 21.25 26.174999999999997 25.674999999999997 26.900000000000002 46 20.75 25.7 25.900000000000002 27.650000000000002 47 22.075 26.0 26.450000000000003 25.474999999999998 48 21.5 28.000000000000004 24.2 26.3 49 21.3 26.900000000000002 24.6 27.200000000000003 50 21.825 27.3 24.8 26.075 51 22.275 26.424999999999997 24.175 27.125 52 21.625 26.950000000000003 25.974999999999998 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 25.0 1 20.0 2 15.0 3 10.0 4 5.0 5 4.0 6 3.0 7 5.5 8 8.0 9 5.5 10 3.0 11 2.0 12 1.0 13 1.5 14 2.0 15 2.0 16 2.5 17 3.0 18 3.5 19 4.0 20 7.5 21 11.0 22 12.0 23 13.0 24 18.5 25 24.0 26 26.5 27 29.0 28 35.0 29 41.0 30 47.5 31 54.0 32 71.5 33 89.0 34 108.5 35 128.0 36 147.0 37 166.0 38 171.0 39 196.5 40 217.0 41 228.0 42 239.0 43 263.0 44 287.0 45 282.0 46 277.0 47 290.5 48 304.0 49 284.0 50 264.0 51 280.5 52 297.0 53 306.0 54 315.0 55 272.0 56 229.0 57 209.0 58 189.0 59 188.5 60 188.0 61 156.5 62 125.0 63 111.0 64 79.5 65 62.0 66 48.5 67 35.0 68 28.5 69 22.0 70 20.5 71 19.0 72 17.5 73 16.0 74 10.0 75 4.0 76 6.0 77 8.0 78 4.5 79 1.0 80 1.0 81 1.0 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57938573659553 93.72500000000001 2 1.691827173347215 3.25 3 0.4424778761061947 1.275 4 0.1301405517959396 0.5 5 0.10411244143675169 0.5 6 0.026028110359187923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026028110359187923 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 24 0.6 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 6 0.15 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra Read 200000 spots for SRR5423350.sra Written 200000 spots for SRR5423350.sra SRR ids: ['SRR5423350.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a4t68j1u SRR5423350.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423350 file size 703970 SRR5423350 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423350 SRR5423350_1.fastq Input file: SRR5423350_1.fastq trimmed: SRR5423350-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:27:45 2025 >> started Wed Feb 12 23:31:51 2025 >> done (246.665s) 4000000 reads processed; of these: 137 ( 0.00%) short reads filtered out after trimming by size control 2921 ( 0.07%) empty reads filtered out after trimming by size control 3996942 (99.92%) reads available; of these: 100906 ( 2.52%) trimmed reads available after processing 3896036 (97.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 10 0.00% 20 10 0.00% 21 2 0.00% 22 4 0.00% 23 8 0.00% 24 6 0.00% 25 8 0.00% 26 14 0.00% 27 14 0.00% 28 11 0.00% 29 17 0.00% 30 33 0.00% 31 28 0.00% 32 37 0.00% 33 43 0.00% 34 46 0.00% 35 56 0.00% 36 68 0.00% 37 80 0.00% 38 111 0.00% 39 165 0.00% 40 155 0.00% 41 234 0.01% 42 310 0.01% 43 382 0.01% 44 571 0.01% 45 778 0.02% 46 1116 0.03% 47 1702 0.04% 48 2732 0.07% 49 5097 0.13% 50 13332 0.33% 51 73710 1.84% 52 3896036 97.48% 3996942 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=1.03 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=19.43 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 12 23:33:23 Started mapping on | Feb 12 23:33:27 Finished on | Feb 12 23:42:38 Mapping speed, Million of reads per hour | 26.11 Number of input reads | 3996942 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3275799 Uniquely mapped reads % | 81.96% Average mapped length | 51.75 Number of splices: Total | 300372 Number of splices: Annotated (sjdb) | 294548 Number of splices: GT/AG | 292667 Number of splices: GC/AG | 5980 Number of splices: AT/AC | 498 Number of splices: Non-canonical | 1227 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427353 % of reads mapped to multiple loci | 10.69% Number of reads mapped to too many loci | 142351 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293790 293790 293790 N_multimapping 427353 427353 427353 N_noFeature 597422 3152834 711512 N_ambiguous 18159 140 9169 UnstrandedReadsAssigned:2660218 PositiveStrandReadsAssigned:122825 NegativeStrandReadsAssigned:2555118 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423350 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423350-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,996,942 reads, 2,858,191 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR5423350.ke.tsv 34699 SRR5423350.se.tsv 87100 total ==> SRR5423350.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 297 55.745 Potri.005G024800.1.v4.1 1035 936 31 11.9292 Potri.004G059700.1.v4.1 961 862 4 1.67139 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.2706 7.25315 Potri.016G087400.1.v4.1 270 171 20 42.1268 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 3.87295 Potri.012G127500.1.v4.1 977 878 136 55.7916 ==> SRR5423350.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423350 completed mapping pipeline successfully