Starting /dee2/code/volunteer_pipeline.sh SRR5423351 current disk space = 3050489618432 free memory = 1579870048 SRR5423351 SRAfilesize 456a446a36c8d61f52116426daf9b60f SRR5423351.sra SRR5423351.sra file validated SRR5423351 is single end SRR5423351 is conventional basespace SRR5423351 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63675 31.0 31.0 34.0 30.0 34.0 2 31.93075 33.0 31.0 34.0 30.0 34.0 3 31.9235 33.0 31.0 34.0 30.0 34.0 4 33.90925 37.0 35.0 37.0 28.0 37.0 5 35.184 37.0 35.0 37.0 32.0 37.0 6 35.346 37.0 35.0 37.0 32.0 37.0 7 35.5265 37.0 35.0 37.0 33.0 37.0 8 35.55375 37.0 35.0 37.0 33.0 37.0 9 37.13675 39.0 37.0 39.0 33.0 39.0 10 36.846 39.0 37.0 39.0 32.0 39.0 11 36.98625 39.0 37.0 39.0 33.0 39.0 12 37.0735 39.0 37.0 39.0 33.0 39.0 13 36.7205 39.0 37.0 39.0 32.0 39.0 14 38.0135 40.0 37.0 41.0 33.0 41.0 15 38.01525 40.0 37.0 41.0 33.0 41.0 16 37.89825 40.0 37.0 41.0 33.0 41.0 17 38.08925 40.0 37.0 41.0 33.0 41.0 18 37.90825 40.0 37.0 41.0 33.0 41.0 19 37.95075 40.0 37.0 41.0 33.0 41.0 20 37.86325 40.0 37.0 41.0 32.0 41.0 21 38.15 40.0 37.0 41.0 33.0 41.0 22 38.04575 40.0 37.0 41.0 33.0 41.0 23 37.71925 40.0 37.0 41.0 32.0 41.0 24 38.1865 40.0 37.0 41.0 34.0 41.0 25 37.929 40.0 37.0 41.0 32.0 41.0 26 37.913 40.0 37.0 41.0 33.0 41.0 27 37.9955 40.0 37.0 41.0 33.0 41.0 28 37.80325 40.0 37.0 41.0 32.0 41.0 29 37.7895 40.0 37.0 41.0 32.0 41.0 30 37.6395 40.0 37.0 41.0 32.0 41.0 31 37.7185 40.0 37.0 41.0 32.0 41.0 32 37.65 40.0 37.0 41.0 32.0 41.0 33 37.73 40.0 37.0 41.0 32.0 41.0 34 37.51975 40.0 37.0 41.0 32.0 41.0 35 37.705 40.0 37.0 41.0 33.0 41.0 36 37.616 40.0 37.0 41.0 32.0 41.0 37 37.44825 40.0 36.0 41.0 31.0 41.0 38 37.28625 39.0 36.0 41.0 31.0 41.0 39 37.14675 39.0 36.0 41.0 31.0 41.0 40 37.106 39.0 36.0 41.0 31.0 41.0 41 37.02 39.0 36.0 41.0 31.0 41.0 42 36.85075 39.0 35.0 41.0 30.0 41.0 43 36.89325 39.0 35.0 41.0 30.0 41.0 44 36.7785 39.0 35.0 40.0 30.0 41.0 45 36.8185 39.0 35.0 40.0 30.0 41.0 46 36.76125 39.0 35.0 40.0 30.0 41.0 47 36.68575 39.0 35.0 41.0 30.0 41.0 48 36.46075 39.0 35.0 40.0 30.0 41.0 49 36.2065 39.0 35.0 40.0 29.0 41.0 50 36.38325 39.0 35.0 40.0 30.0 41.0 51 36.187 39.0 35.0 40.0 28.0 41.0 52 35.468 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2213 1 0.0 2213 2 0.0 2213 3 0.0 2213 4 0.0 2213 5 0.0 2213 6 0.0 2213 7 0.0 2213 8 0.0 2213 9 0.0 2213 10 0.0 2213 11 0.0 2213 12 0.0 2213 13 0.0 2213 14 0.0 2213 15 0.0 2213 16 0.0 2213 17 0.0 2213 18 0.0 2213 19 0.0 2213 20 0.0 2213 21 0.0 2213 22 0.0 2213 23 0.0 2213 24 0.0 2213 25 0.0 2213 26 0.0 2213 27 0.0 2213 28 0.0 2213 29 0.0 2213 30 0.0 2213 31 0.0 2213 32 0.0 2213 33 0.0 2213 34 0.0 2213 35 0.0 2213 36 0.0 2213 37 0.0 2213 38 0.0 2213 39 0.0 2213 40 0.0 2213 41 0.0 2213 42 0.0 2213 43 0.0 2213 44 0.0 2213 45 0.0 2213 46 0.0 2213 47 0.0 2213 48 0.0 2213 49 0.0 2213 50 0.0 2213 51 0.0 2213 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 5.0 23 9.0 24 12.0 25 9.0 26 16.0 27 38.0 28 41.0 29 64.0 30 61.0 31 105.0 32 132.0 33 178.0 34 195.0 35 309.0 36 357.0 37 460.0 38 769.0 39 1229.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.0565424068051 13.385038779084313 5.529146860145109 39.02927195396547 2 22.225 15.2 34.699999999999996 27.875 3 18.825 19.05 25.35 36.775000000000006 4 23.1 27.150000000000002 22.0 27.750000000000004 5 23.775 32.05 22.5 21.675 6 19.425 35.375 22.900000000000002 22.3 7 14.825 24.95 41.85 18.375 8 18.675 22.625 30.4 28.299999999999997 9 18.2 21.625 33.550000000000004 26.625 10 19.35 37.275000000000006 24.675 18.7 11 22.425 29.15 21.475 26.950000000000003 12 21.15 26.25 26.474999999999998 26.125 13 20.325 28.499999999999996 26.125 25.05 14 19.650000000000002 27.800000000000004 28.275 24.275 15 21.55 26.650000000000002 26.1 25.7 16 21.8 26.400000000000002 25.900000000000002 25.900000000000002 17 21.349999999999998 26.325 26.1 26.224999999999998 18 21.325 26.950000000000003 25.95 25.775 19 21.099999999999998 26.674999999999997 26.275 25.95 20 21.349999999999998 26.474999999999998 26.625 25.55 21 22.15 26.0 25.35 26.5 22 19.975 28.975 25.424999999999997 25.624999999999996 23 21.325 27.425 25.374999999999996 25.874999999999996 24 20.95 26.8 25.974999999999998 26.275 25 22.6 28.675 24.525 24.2 26 22.15 27.474999999999998 25.8 24.575 27 21.575 27.450000000000003 24.575 26.400000000000002 28 21.099999999999998 28.4 25.424999999999997 25.074999999999996 29 22.475 26.625 25.15 25.75 30 21.9 25.6 25.174999999999997 27.325 31 21.875 26.85 24.675 26.6 32 21.425 27.224999999999998 25.374999999999996 25.974999999999998 33 22.55 26.724999999999998 25.275 25.45 34 21.425 26.575 26.775 25.224999999999998 35 21.2 26.900000000000002 25.525 26.375 36 20.474999999999998 27.275 24.525 27.725 37 21.125 27.0 24.725 27.150000000000002 38 20.674999999999997 28.449999999999996 24.725 26.150000000000002 39 21.85 26.05 25.15 26.950000000000003 40 20.575 28.000000000000004 25.424999999999997 26.0 41 21.775 26.825 25.6 25.8 42 22.275 24.9 25.874999999999996 26.950000000000003 43 21.9 26.375 24.825 26.900000000000002 44 21.625 25.974999999999998 25.674999999999997 26.724999999999998 45 21.825 25.6 25.75 26.825 46 22.05 25.874999999999996 25.45 26.625 47 22.475 26.1 26.275 25.15 48 22.508763144717076 26.91537305958938 25.137706559839764 25.43815723585378 49 22.6 24.85 25.55 27.0 50 21.6 25.825 25.275 27.3 51 21.605401350337583 26.156539134783696 24.55613903475869 27.68192048012003 52 22.05 27.3 24.15 26.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 18.0 1 12.5 2 7.0 3 7.0 4 7.0 5 5.5 6 4.0 7 3.0 8 2.0 9 2.5 10 3.0 11 3.5 12 4.0 13 3.5 14 2.0 15 1.0 16 3.0 17 5.0 18 5.5 19 6.0 20 6.5 21 7.0 22 9.5 23 12.0 24 11.5 25 11.0 26 19.0 27 27.0 28 32.0 29 37.0 30 46.5 31 56.0 32 75.5 33 95.0 34 118.0 35 141.0 36 142.5 37 144.0 38 162.0 39 203.5 40 227.0 41 239.0 42 251.0 43 251.5 44 252.0 45 267.5 46 283.0 47 293.0 48 303.0 49 293.0 50 283.0 51 308.5 52 334.0 53 298.0 54 262.0 55 252.0 56 242.0 57 228.0 58 214.0 59 195.0 60 176.0 61 156.0 62 136.0 63 115.5 64 76.0 65 57.0 66 47.0 67 37.0 68 33.5 69 30.0 70 19.5 71 9.0 72 9.0 73 9.0 74 10.0 75 11.0 76 10.0 77 9.0 78 7.0 79 5.0 80 4.0 81 3.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.15 49 0.0 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.06036745406824 92.45 2 1.889763779527559 3.5999999999999996 3 0.6824146981627297 1.95 4 0.1837270341207349 0.7000000000000001 5 0.10498687664041995 0.5 6 0.026246719160104987 0.15 7 0.0 0.0 8 0.026246719160104987 0.2 9 0.0 0.0 >10 0.026246719160104987 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 18 0.44999999999999996 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 8 0.2 No Hit CTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGA 6 0.15 No Hit GATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCG 5 0.125 No Hit GTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAG 5 0.125 No Hit GCAGCAGCTAGTTCAGGGCTCCATTTGCTAGCTTCACGGATAATTTCATTAC 5 0.125 No Hit CAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra Read 200000 spots for SRR5423351.sra Written 200000 spots for SRR5423351.sra SRR ids: ['SRR5423351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e5ze5oe1 SRR5423351.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423351 file size 703952 SRR5423351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423351 SRR5423351_1.fastq Input file: SRR5423351_1.fastq trimmed: SRR5423351-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:26:41 2025 >> started Wed Feb 12 23:30:49 2025 >> done (247.507s) 4000000 reads processed; of these: 147 ( 0.00%) short reads filtered out after trimming by size control 2935 ( 0.07%) empty reads filtered out after trimming by size control 3996918 (99.92%) reads available; of these: 80931 ( 2.02%) trimmed reads available after processing 3915987 (97.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 10 0.00% 26 4 0.00% 27 11 0.00% 28 6 0.00% 29 10 0.00% 30 10 0.00% 31 19 0.00% 32 28 0.00% 33 24 0.00% 34 33 0.00% 35 37 0.00% 36 45 0.00% 37 56 0.00% 38 79 0.00% 39 121 0.00% 40 132 0.00% 41 181 0.00% 42 220 0.01% 43 328 0.01% 44 430 0.01% 45 586 0.01% 46 821 0.02% 47 1273 0.03% 48 2045 0.05% 49 3961 0.10% 50 10328 0.26% 51 60111 1.50% 52 3915987 97.98% 3996918 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=1.04 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=10.63 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.7 sequence=CCATCATCCAATCCACGAATGAAACCTGGCGAAAAAGAAGTTCACACTTTCTGGCGACGTCTTTCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTTCGCCTT Started job on | Feb 12 23:35:40 Started mapping on | Feb 12 23:35:58 Finished on | Feb 13 00:05:15 Mapping speed, Million of reads per hour | 8.19 Number of input reads | 3996918 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3273420 Uniquely mapped reads % | 81.90% Average mapped length | 51.76 Number of splices: Total | 299057 Number of splices: Annotated (sjdb) | 293288 Number of splices: GT/AG | 291426 Number of splices: GC/AG | 5915 Number of splices: AT/AC | 490 Number of splices: Non-canonical | 1226 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428998 % of reads mapped to multiple loci | 10.73% Number of reads mapped to too many loci | 143596 % of reads mapped to too many loci | 3.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 294500 294500 294500 N_multimapping 428998 428998 428998 N_noFeature 599936 3150512 713952 N_ambiguous 18124 125 9124 UnstrandedReadsAssigned:2655360 PositiveStrandReadsAssigned:122783 NegativeStrandReadsAssigned:2550344 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423351 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423351-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,996,918 reads, 2,836,200 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR5423351.ke.tsv 34699 SRR5423351.se.tsv 87100 total ==> SRR5423351.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 289 54.636 Potri.005G024800.1.v4.1 1035 936 19 7.36434 Potri.004G059700.1.v4.1 961 862 3 1.26261 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64.2957 8.20178 Potri.016G087400.1.v4.1 270 171 11 23.3374 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23.6975 5.13573 Potri.012G127500.1.v4.1 977 878 135 55.7821 ==> SRR5423351.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 55 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423351 completed mapping pipeline successfully