Starting /dee2/code/volunteer_pipeline.sh SRR5423352 current disk space = 3050479308800 free memory = 1575484228 SRR5423352 SRAfilesize 742a7d83bee09bd7650bbd0e40354e23 SRR5423352.sra SRR5423352.sra file validated SRR5423352 is single end SRR5423352 is conventional basespace SRR5423352 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.93875 33.0 31.0 34.0 30.0 34.0 2 31.79825 33.0 31.0 34.0 30.0 34.0 3 32.09875 34.0 31.0 34.0 30.0 34.0 4 34.93775 37.0 35.0 37.0 32.0 37.0 5 35.24775 37.0 35.0 37.0 32.0 37.0 6 35.505 37.0 35.0 37.0 33.0 37.0 7 35.39325 37.0 35.0 37.0 33.0 37.0 8 35.61525 37.0 35.0 37.0 33.0 37.0 9 37.18375 39.0 37.0 39.0 33.0 39.0 10 37.3455 39.0 37.0 39.0 34.0 39.0 11 37.379 39.0 37.0 39.0 34.0 39.0 12 37.41 39.0 37.0 39.0 34.0 39.0 13 37.24775 39.0 37.0 39.0 33.0 39.0 14 38.45 40.0 38.0 41.0 34.0 41.0 15 38.516 40.0 38.0 41.0 34.0 41.0 16 38.2325 40.0 38.0 41.0 33.0 41.0 17 38.3845 40.0 38.0 41.0 34.0 41.0 18 38.49775 40.0 38.0 41.0 34.0 41.0 19 38.4885 40.0 38.0 41.0 34.0 41.0 20 38.285 40.0 38.0 41.0 34.0 41.0 21 38.331 40.0 38.0 41.0 34.0 41.0 22 38.2495 40.0 38.0 41.0 33.0 41.0 23 38.27375 40.0 38.0 41.0 33.0 41.0 24 38.07025 40.0 37.0 41.0 33.0 41.0 25 38.29525 40.0 38.0 41.0 34.0 41.0 26 38.33425 40.0 38.0 41.0 34.0 41.0 27 38.217 40.0 38.0 41.0 34.0 41.0 28 38.02625 40.0 37.0 41.0 33.0 41.0 29 37.70725 40.0 37.0 41.0 32.0 41.0 30 37.759 40.0 37.0 41.0 32.0 41.0 31 37.893 40.0 37.0 41.0 33.0 41.0 32 37.75225 40.0 37.0 41.0 32.0 41.0 33 37.7755 40.0 37.0 41.0 33.0 41.0 34 37.788 40.0 37.0 41.0 33.0 41.0 35 37.72025 40.0 37.0 41.0 32.0 41.0 36 37.79375 40.0 37.0 41.0 33.0 41.0 37 37.4105 40.0 37.0 41.0 31.0 41.0 38 37.4635 40.0 37.0 41.0 31.0 41.0 39 37.546 40.0 37.0 41.0 32.0 41.0 40 37.3545 40.0 36.0 41.0 31.0 41.0 41 37.26775 40.0 36.0 41.0 31.0 41.0 42 37.14375 39.0 36.0 41.0 31.0 41.0 43 37.083 39.0 36.0 41.0 31.0 41.0 44 37.10975 39.0 36.0 41.0 31.0 41.0 45 37.0915 39.0 36.0 41.0 31.0 41.0 46 36.765 39.0 35.0 41.0 30.0 41.0 47 36.85925 39.0 35.0 41.0 30.0 41.0 48 36.9785 39.0 35.0 41.0 31.0 41.0 49 36.97075 39.0 35.0 41.0 31.0 41.0 50 36.78675 39.0 35.0 41.0 30.0 41.0 51 36.70675 39.0 35.0 41.0 30.0 41.0 52 35.80925 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2310 1 0.0 2310 2 0.0 2310 3 0.0 2310 4 0.0 2310 5 0.0 2310 6 0.0 2310 7 0.0 2310 8 0.0 2310 9 0.0 2310 10 0.0 2310 11 0.0 2310 12 0.0 2310 13 0.0 2310 14 0.0 2310 15 0.0 2310 16 0.0 2310 17 0.0 2310 18 0.0 2310 19 0.0 2310 20 0.0 2310 21 0.0 2310 22 0.0 2310 23 0.0 2310 24 0.0 2310 25 0.0 2310 26 0.0 2310 27 0.0 2310 28 0.0 2310 29 0.0 2310 30 0.0 2310 31 0.0 2310 32 0.0 2310 33 0.0 2310 34 0.0 2310 35 0.0 2310 36 0.0 2310 37 0.0 2310 38 0.0 2310 39 0.0 2310 40 0.0 2310 41 0.0 2310 42 0.0 2310 43 0.0 2310 44 0.0 2310 45 0.0 2310 46 0.0 2310 47 0.0 2310 48 0.0 2310 49 0.0 2310 50 0.0 2310 51 0.0 2310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 4.0 21 3.0 22 5.0 23 10.0 24 6.0 25 10.0 26 20.0 27 35.0 28 31.0 29 59.0 30 80.0 31 79.0 32 112.0 33 119.0 34 188.0 35 269.0 36 331.0 37 433.0 38 718.0 39 1478.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.76044011002751 13.12828207051763 6.2015503875969 38.90972743185797 2 21.4 14.85 35.175 28.575 3 19.85 19.950000000000003 23.75 36.449999999999996 4 23.775 28.449999999999996 21.75 26.025 5 24.775 32.425 22.2 20.599999999999998 6 20.474999999999998 35.55 21.85 22.125 7 15.325 25.724999999999998 40.300000000000004 18.65 8 17.65 24.025 30.15 28.175 9 17.9 22.425 32.074999999999996 27.6 10 20.0 36.35 24.25 19.400000000000002 11 23.0 27.450000000000003 22.8 26.75 12 22.475 24.625 25.5 27.400000000000002 13 19.900000000000002 28.325 27.275 24.5 14 20.325 28.775000000000002 27.950000000000003 22.95 15 21.65 26.575 25.525 26.25 16 20.849999999999998 27.750000000000004 24.474999999999998 26.924999999999997 17 20.849999999999998 27.1 26.224999999999998 25.825 18 19.525000000000002 28.749999999999996 25.624999999999996 26.1 19 21.2 26.825 25.874999999999996 26.1 20 20.9 25.374999999999996 27.6 26.125 21 20.0 25.124999999999996 26.3 28.575 22 20.45 28.4 25.775 25.374999999999996 23 21.625 27.775 25.1 25.5 24 21.525 25.8 26.450000000000003 26.224999999999998 25 20.200000000000003 26.5 26.125 27.175 26 22.15 27.150000000000002 25.424999999999997 25.275 27 19.7 26.200000000000003 26.150000000000002 27.950000000000003 28 22.2 27.275 25.6 24.925 29 21.3 26.174999999999997 25.724999999999998 26.8 30 22.375 26.125 25.825 25.674999999999997 31 22.25 27.400000000000002 24.65 25.7 32 21.3 27.525 25.074999999999996 26.1 33 21.775 25.7 27.1 25.424999999999997 34 21.65 27.450000000000003 25.775 25.124999999999996 35 22.45 25.6 25.45 26.5 36 21.224999999999998 28.025 23.724999999999998 27.025 37 21.925 26.400000000000002 25.650000000000002 26.025 38 22.025 27.575 24.9 25.5 39 23.425 25.15 24.625 26.8 40 21.15 28.749999999999996 25.124999999999996 24.975 41 21.7 27.1 25.074999999999996 26.125 42 22.075 26.375 25.474999999999998 26.075 43 21.6 27.224999999999998 24.75 26.424999999999997 44 21.975 26.3 25.275 26.450000000000003 45 21.025 26.025 26.25 26.700000000000003 46 22.2 26.5 25.174999999999997 26.125 47 23.25 24.3 25.974999999999998 26.474999999999998 48 20.9 26.875 25.525 26.700000000000003 49 22.425 25.624999999999996 24.725 27.224999999999998 50 22.025 26.0 25.6 26.375 51 22.575 25.074999999999996 25.275 27.075 52 22.175 27.675 24.349999999999998 25.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 25.0 1 17.0 2 9.0 3 8.0 4 7.0 5 5.5 6 4.0 7 4.0 8 4.0 9 3.5 10 3.0 11 3.0 12 3.0 13 1.5 14 1.0 15 2.0 16 2.0 17 2.0 18 3.0 19 4.0 20 8.0 21 12.0 22 11.0 23 10.0 24 14.0 25 18.0 26 21.5 27 25.0 28 30.5 29 36.0 30 52.0 31 68.0 32 79.5 33 91.0 34 99.5 35 108.0 36 131.5 37 155.0 38 159.0 39 195.5 40 228.0 41 239.5 42 251.0 43 252.0 44 253.0 45 268.0 46 283.0 47 284.0 48 285.0 49 291.5 50 298.0 51 301.0 52 304.0 53 308.0 54 312.0 55 277.0 56 242.0 57 224.0 58 206.0 59 190.0 60 174.0 61 156.0 62 138.0 63 113.5 64 79.0 65 69.0 66 55.0 67 41.0 68 32.0 69 23.0 70 21.0 71 19.0 72 14.0 73 9.0 74 7.5 75 6.0 76 8.0 77 10.0 78 6.5 79 3.0 80 3.5 81 4.0 82 3.5 83 3.0 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.52612039246884 91.0 2 2.2275258552108195 4.2 3 0.8220631132325642 2.325 4 0.21214531954388757 0.8 5 0.10607265977194379 0.5 6 0.026518164942985947 0.15 7 0.026518164942985947 0.17500000000000002 8 0.0 0.0 9 0.026518164942985947 0.22499999999999998 >10 0.026518164942985947 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 25 0.625 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 9 0.22499999999999998 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 7 0.17500000000000002 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 5 0.125 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 5 0.125 No Hit CTTTAGATAACAAAAAGTGGGAGCCCCGTCAGGTCGCCAAACTACGACGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112318 spots for SRR5423352.sra Written 112318 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra Read 112299 spots for SRR5423352.sra Written 112299 spots for SRR5423352.sra SRR ids: ['SRR5423352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86j2qdbi SRR5423352.sra spots: 2245999 blocks: [[1, 112299], [112300, 224598], [224599, 336897], [336898, 449196], [449197, 561495], [561496, 673794], [673795, 786093], [786094, 898392], [898393, 1010691], [1010692, 1122990], [1122991, 1235289], [1235290, 1347588], [1347589, 1459887], [1459888, 1572186], [1572187, 1684485], [1684486, 1796784], [1796785, 1909083], [1909084, 2021382], [2021383, 2133681], [2133682, 2245999]] SRR5423352 file size 394804 SRR5423352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423352 SRR5423352_1.fastq Input file: SRR5423352_1.fastq trimmed: SRR5423352-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:22:21 2025 >> started Wed Feb 12 23:30:51 2025 >> done (509.429s) 2245999 reads processed; of these: 83 ( 0.00%) short reads filtered out after trimming by size control 1674 ( 0.07%) empty reads filtered out after trimming by size control 2244242 (99.92%) reads available; of these: 38493 ( 1.72%) trimmed reads available after processing 2205749 (98.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 4 0.00% 29 2 0.00% 30 6 0.00% 31 2 0.00% 32 1 0.00% 33 4 0.00% 34 11 0.00% 35 6 0.00% 36 8 0.00% 37 17 0.00% 38 25 0.00% 39 23 0.00% 40 29 0.00% 41 43 0.00% 42 66 0.00% 43 72 0.00% 44 135 0.01% 45 189 0.01% 46 243 0.01% 47 371 0.02% 48 652 0.03% 49 1411 0.06% 50 4455 0.20% 51 30700 1.37% 52 2205749 98.28% 2244242 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=20 prefix-density=0.64 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=10.58 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=CCATCATCCAATCCACGAATGAAACCTGGCGAAAAAGAAGTTCACACTTTCTGGCGACGTCTTTCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTTCGCCTTT Started job on | Feb 12 23:33:03 Started mapping on | Feb 12 23:33:06 Finished on | Feb 12 23:37:55 Mapping speed, Million of reads per hour | 27.96 Number of input reads | 2244242 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 1835628 Uniquely mapped reads % | 81.79% Average mapped length | 51.77 Number of splices: Total | 166683 Number of splices: Annotated (sjdb) | 163474 Number of splices: GT/AG | 162473 Number of splices: GC/AG | 3268 Number of splices: AT/AC | 276 Number of splices: Non-canonical | 666 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242277 % of reads mapped to multiple loci | 10.80% Number of reads mapped to too many loci | 81587 % of reads mapped to too many loci | 3.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 166337 166337 166337 N_multimapping 242277 242277 242277 N_noFeature 338829 1768378 401246 N_ambiguous 10085 87 5172 UnstrandedReadsAssigned:1486714 PositiveStrandReadsAssigned:67163 NegativeStrandReadsAssigned:1429210 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423352 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423352-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,244,242 reads, 1,602,309 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,002 rounds 52401 SRR5423352.ke.tsv 34699 SRR5423352.se.tsv 87100 total ==> SRR5423352.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 199 66.3088 Potri.005G024800.1.v4.1 1035 936 16 10.9304 Potri.004G059700.1.v4.1 961 862 1 0.741798 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.3158 8.61472 Potri.016G087400.1.v4.1 270 171 8 29.9149 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 4.20175 Potri.012G127500.1.v4.1 977 878 69 50.2513 ==> SRR5423352.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 23 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423352 completed mapping pipeline successfully