Starting /dee2/code/volunteer_pipeline.sh SRR5423353 current disk space = 3050494111744 free memory = 1576972696 SRR5423353 SRAfilesize 53e8ba246c2736c3e0f2457901936ed1 SRR5423353.sra SRR5423353.sra file validated SRR5423353 is single end SRR5423353 is conventional basespace SRR5423353 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.90425 16.0 16.0 28.0 16.0 30.0 2 22.73875 25.0 16.0 30.0 16.0 30.0 3 24.401 28.0 16.0 30.0 16.0 31.0 4 29.11075 32.0 19.0 35.0 19.0 35.0 5 23.0355 19.0 19.0 30.0 10.0 35.0 6 22.35425 17.0 17.0 31.0 10.0 33.0 7 23.40775 25.0 17.0 32.0 10.0 35.0 8 24.3935 28.0 17.0 32.0 11.0 35.0 9 24.401 27.0 17.0 32.0 10.0 35.0 10 26.38775 28.0 17.0 34.0 15.0 35.0 11 27.16425 30.0 18.0 34.0 15.0 35.0 12 25.987 27.0 17.0 34.0 11.0 35.0 13 26.407 27.0 17.0 34.0 11.0 35.0 14 27.2125 30.0 19.0 34.0 11.0 36.0 15 28.171 31.0 25.0 34.0 16.0 37.0 16 28.023 31.0 24.0 34.0 16.0 37.0 17 27.7825 31.0 24.0 34.0 15.0 37.0 18 24.66075 27.0 17.0 32.0 10.0 36.0 19 26.3305 27.0 18.0 34.0 10.0 37.0 20 26.00275 27.0 18.0 34.0 10.0 37.0 21 27.00875 30.0 19.0 34.0 10.0 37.0 22 26.2655 28.0 18.0 34.0 10.0 37.0 23 25.228 27.0 18.0 33.0 10.0 36.0 24 25.152 27.0 18.0 33.0 10.0 36.0 25 23.88975 27.0 16.0 32.0 10.0 36.0 26 20.29 18.0 10.0 30.0 8.0 34.0 27 20.83 19.0 10.0 30.0 8.0 34.0 28 21.56225 23.0 11.0 30.0 8.0 34.0 29 22.72675 25.0 15.0 31.0 8.0 35.0 30 23.149 25.0 15.0 32.0 8.0 35.0 31 23.13625 25.0 15.0 32.0 8.0 35.0 32 18.51625 16.0 9.0 27.0 8.0 33.0 33 20.25125 19.0 10.0 30.0 8.0 34.0 34 21.38875 23.0 12.0 30.0 8.0 34.0 35 21.3395 23.0 10.0 30.0 8.0 34.0 36 20.0375 19.0 9.0 30.0 8.0 34.0 37 19.78325 18.0 9.0 30.0 8.0 34.0 38 19.597 18.0 9.0 30.0 8.0 33.0 39 20.1545 21.0 9.0 30.0 8.0 33.0 40 19.78625 20.0 9.0 30.0 8.0 33.0 41 21.0855 23.0 12.0 30.0 8.0 34.0 42 20.6535 22.0 9.0 30.0 8.0 34.0 43 20.95725 23.0 12.0 30.0 8.0 34.0 44 21.252 23.0 12.0 30.0 8.0 34.0 45 20.49225 22.0 9.0 30.0 8.0 33.0 46 19.48375 20.0 9.0 29.0 7.0 33.0 47 19.4105 19.0 9.0 28.0 7.0 33.0 48 19.9 21.0 9.0 29.0 7.0 33.0 49 19.12625 19.0 9.0 28.0 7.0 33.0 50 18.735 18.0 9.0 28.0 7.0 33.0 51 17.00425 14.0 8.0 24.0 7.0 31.0 52 16.46525 13.0 8.0 24.0 7.0 30.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 13 5.0 14 13.0 15 43.0 16 77.0 17 135.0 18 216.0 19 291.0 20 361.0 21 465.0 22 496.0 23 480.0 24 444.0 25 365.0 26 225.0 27 174.0 28 119.0 29 54.0 30 27.0 31 8.0 32 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.075 15.925 5.075 36.925000000000004 2 18.975 15.475 35.949999999999996 29.599999999999998 3 19.375 19.15 24.725 36.75 4 21.075 27.025 25.75 26.150000000000002 5 38.425 25.0 9.875 26.700000000000003 6 20.325 31.55 23.974999999999998 24.15 7 14.95 22.900000000000002 41.175 20.974999999999998 8 15.75 22.075 29.675 32.5 9 21.2 20.424999999999997 33.800000000000004 24.575 10 20.1 32.875 24.575 22.45 11 22.125 23.375 22.25 32.25 12 21.575 22.725 28.199999999999996 27.500000000000004 13 21.525 25.374999999999996 24.925 28.175 14 20.075000000000003 24.349999999999998 29.7 25.874999999999996 15 20.225 22.25 30.075000000000003 27.450000000000003 16 24.675 22.55 25.7 27.075 17 22.925 23.05 27.325 26.700000000000003 18 22.95 23.799999999999997 25.275 27.975 19 18.725 27.400000000000002 26.75 27.125 20 20.65 26.200000000000003 26.125 27.025 21 21.349999999999998 23.225 26.974999999999998 28.449999999999996 22 21.85 26.825 24.425 26.900000000000002 23 23.1 23.7 24.8 28.4 24 22.8 26.875 25.424999999999997 24.9 25 22.875 25.174999999999997 24.2 27.750000000000004 26 23.225 25.674999999999997 24.375 26.724999999999998 27 21.25 27.875 22.575 28.299999999999997 28 22.925 25.5 27.125 24.45 29 23.5 21.775 27.950000000000003 26.775 30 22.35 24.825 26.474999999999998 26.35 31 22.325 27.150000000000002 24.175 26.35 32 21.6 26.325 24.224999999999998 27.85 33 21.75 25.75 26.724999999999998 25.775 34 22.0 23.724999999999998 26.525 27.750000000000004 35 21.95 27.224999999999998 24.2 26.625 36 20.175 27.775 23.674999999999997 28.375 37 23.549999999999997 27.425 23.95 25.074999999999996 38 24.875 24.349999999999998 22.75 28.025 39 23.775 23.0 26.700000000000003 26.525 40 20.825 26.700000000000003 24.55 27.925 41 23.674999999999997 22.650000000000002 25.95 27.725 42 22.7 25.124999999999996 24.224999999999998 27.950000000000003 43 23.599999999999998 22.650000000000002 25.474999999999998 28.275 44 23.425 25.224999999999998 22.375 28.975 45 21.525 25.825 24.9 27.750000000000004 46 21.55 24.625 23.45 30.375000000000004 47 21.275 25.650000000000002 23.549999999999997 29.525000000000002 48 22.780695173793447 24.48112028007002 24.93123280820205 27.806951737934483 49 22.425 26.900000000000002 22.05 28.625 50 23.849999999999998 26.424999999999997 24.725 25.0 51 22.325 27.6 25.474999999999998 24.6 52 23.400000000000002 26.05 25.05 25.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 11.0 2 14.0 3 13.5 4 13.0 5 9.0 6 5.0 7 9.0 8 13.0 9 12.5 10 12.0 11 7.5 12 3.0 13 2.0 14 1.0 15 1.0 16 2.5 17 4.0 18 6.0 19 8.0 20 7.5 21 7.0 22 8.0 23 9.0 24 15.5 25 22.0 26 21.0 27 20.0 28 34.0 29 48.0 30 50.5 31 53.0 32 61.0 33 69.0 34 92.5 35 116.0 36 139.5 37 163.0 38 179.0 39 185.0 40 175.0 41 202.5 42 230.0 43 231.0 44 232.0 45 240.0 46 248.0 47 246.0 48 244.0 49 240.5 50 237.0 51 240.0 52 243.0 53 236.0 54 229.0 55 223.5 56 218.0 57 211.0 58 204.0 59 193.5 60 183.0 61 163.5 62 144.0 63 133.0 64 108.5 65 95.0 66 80.0 67 65.0 68 65.0 69 65.0 70 63.0 71 61.0 72 59.0 73 57.0 74 52.5 75 48.0 76 40.0 77 32.0 78 31.5 79 31.0 80 22.5 81 14.0 82 14.5 83 15.0 84 14.5 85 14.0 86 9.0 87 4.0 88 3.5 89 2.0 90 1.0 91 0.5 92 0.0 93 1.0 94 2.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54703033392812 96.65 2 1.2235534030079023 2.4 3 0.07647208768799389 0.22499999999999998 4 0.10196278358399186 0.4 5 0.0 0.0 6 0.025490695895997964 0.15 7 0.025490695895997964 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit AAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7918 spots for SRR5423353.sra Written 7918 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra Read 7903 spots for SRR5423353.sra Written 7903 spots for SRR5423353.sra SRR ids: ['SRR5423353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_psepe1ys SRR5423353.sra spots: 158075 blocks: [[1, 7903], [7904, 15806], [15807, 23709], [23710, 31612], [31613, 39515], [39516, 47418], [47419, 55321], [55322, 63224], [63225, 71127], [71128, 79030], [79031, 86933], [86934, 94836], [94837, 102739], [102740, 110642], [110643, 118545], [118546, 126448], [126449, 134351], [134352, 142254], [142255, 150157], [150158, 158075]] SRR5423353 file size 27598 SRR5423353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423353 SRR5423353_1.fastq Input file: SRR5423353_1.fastq trimmed: SRR5423353-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:24:01 2025 >> started Wed Feb 12 23:24:36 2025 >> done (34.919s) 158075 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 35 ( 0.02%) empty reads filtered out after trimming by size control 158037 (99.98%) reads available; of these: 34317 (21.71%) trimmed reads available after processing 123720 (78.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 3 0.00% 40 3 0.00% 41 9 0.01% 42 13 0.01% 43 19 0.01% 44 37 0.02% 45 68 0.04% 46 110 0.07% 47 323 0.20% 48 779 0.49% 49 1979 1.25% 50 6561 4.15% 51 24410 15.45% 52 123720 78.29% 158037 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=9 prefix-density=0.61 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=6.36 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=1.4 sequence=TCTAGGAGCCAGAACACC Started job on | Feb 12 23:26:04 Started mapping on | Feb 12 23:26:07 Finished on | Feb 12 23:27:14 Mapping speed, Million of reads per hour | 8.49 Number of input reads | 158037 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 107152 Uniquely mapped reads % | 67.80% Average mapped length | 51.19 Number of splices: Total | 8550 Number of splices: Annotated (sjdb) | 8322 Number of splices: GT/AG | 8356 Number of splices: GC/AG | 148 Number of splices: AT/AC | 11 Number of splices: Non-canonical | 35 Mismatch rate per base, % | 3.35% Deletion rate per base | 0.00% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 14931 % of reads mapped to multiple loci | 9.45% Number of reads mapped to too many loci | 4543 % of reads mapped to too many loci | 2.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.48% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 35954 35954 35954 N_multimapping 14931 14931 14931 N_noFeature 19491 103287 23104 N_ambiguous 535 0 283 UnstrandedReadsAssigned:87126 PositiveStrandReadsAssigned:3865 NegativeStrandReadsAssigned:83765 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=51 echo kmer=47 SRR5423353 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423353-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 158,037 reads, 60,778 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 728 rounds 52401 SRR5423353.ke.tsv 34699 SRR5423353.se.tsv 87100 total ==> SRR5423353.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2 17.3387 Potri.005G024800.1.v4.1 1035 936 1 17.774 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 0 0 Potri.016G087400.1.v4.1 270 171 0 0 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 3 56.8445 ==> SRR5423353.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 0 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423353 completed mapping pipeline successfully