Starting /dee2/code/volunteer_pipeline.sh SRR5423354 current disk space = 3050712256512 free memory = 1576729472 SRR5423354 SRAfilesize 80fedbe63f1bd3a68bea98d92ffa24a6 SRR5423354.sra SRR5423354.sra file validated SRR5423354 is single end SRR5423354 is conventional basespace SRR5423354 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.74825 31.0 30.0 33.0 28.0 34.0 2 31.31625 31.0 31.0 34.0 28.0 34.0 3 31.273 31.0 31.0 34.0 28.0 34.0 4 31.122 35.0 28.0 37.0 16.0 37.0 5 33.5905 35.0 33.0 37.0 28.0 37.0 6 34.61225 35.0 35.0 37.0 32.0 37.0 7 35.04525 35.0 35.0 37.0 32.0 37.0 8 35.025 36.0 35.0 37.0 32.0 37.0 9 36.65425 39.0 35.0 39.0 32.0 39.0 10 36.49475 39.0 35.0 39.0 32.0 39.0 11 36.7005 39.0 35.0 39.0 32.0 39.0 12 36.7065 39.0 35.0 39.0 32.0 39.0 13 36.7895 39.0 37.0 39.0 32.0 39.0 14 37.71925 40.0 37.0 41.0 32.0 41.0 15 37.971 40.0 37.0 41.0 33.0 41.0 16 37.7525 40.0 37.0 41.0 32.0 41.0 17 37.77925 40.0 37.0 41.0 33.0 41.0 18 37.5355 39.0 36.0 41.0 32.0 41.0 19 37.572 39.0 37.0 41.0 32.0 41.0 20 37.234 39.0 36.0 41.0 31.0 41.0 21 37.61325 39.0 36.0 41.0 32.0 41.0 22 37.73625 39.0 37.0 41.0 33.0 41.0 23 37.367 39.0 36.0 41.0 31.0 41.0 24 37.36 39.0 36.0 41.0 32.0 41.0 25 37.32975 39.0 36.0 41.0 32.0 41.0 26 37.29525 39.0 36.0 41.0 31.0 41.0 27 36.9395 39.0 36.0 40.0 30.0 41.0 28 36.93325 39.0 36.0 40.0 30.0 41.0 29 37.19 39.0 36.0 41.0 31.0 41.0 30 36.7565 39.0 35.0 40.0 30.0 41.0 31 36.74125 39.0 35.0 40.0 30.0 41.0 32 37.027 39.0 36.0 40.0 31.0 41.0 33 36.91675 39.0 36.0 40.0 30.0 41.0 34 36.767 39.0 35.0 40.0 30.0 41.0 35 36.89075 39.0 35.0 40.0 30.0 41.0 36 36.6965 39.0 35.0 40.0 30.0 41.0 37 36.66875 39.0 35.0 40.0 30.0 41.0 38 36.594 39.0 35.0 40.0 30.0 41.0 39 36.78875 39.0 35.0 40.0 30.0 41.0 40 36.28 39.0 35.0 40.0 29.0 41.0 41 36.263 38.0 35.0 40.0 29.0 41.0 42 36.046 38.0 35.0 40.0 28.0 41.0 43 36.206 38.0 35.0 40.0 30.0 41.0 44 36.09725 38.0 35.0 40.0 29.0 41.0 45 36.2925 38.0 35.0 40.0 29.0 41.0 46 36.4455 38.0 35.0 40.0 30.0 41.0 47 36.3085 38.0 35.0 40.0 30.0 41.0 48 35.877 38.0 34.0 40.0 28.0 41.0 49 36.17325 38.0 35.0 40.0 28.0 41.0 50 36.1935 38.0 34.0 40.0 29.0 41.0 51 35.95925 38.0 34.0 40.0 28.0 41.0 52 35.06075 37.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 1.0 21 2.0 22 4.0 23 4.0 24 14.0 25 25.0 26 34.0 27 35.0 28 63.0 29 87.0 30 102.0 31 122.0 32 148.0 33 198.0 34 269.0 35 348.0 36 414.0 37 543.0 38 688.0 39 893.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.7312984738554 13.485113835376533 5.42907180385289 39.35451588691519 2 20.45 14.975 35.875 28.7 3 19.1 19.325 25.724999999999998 35.85 4 24.375 26.875 21.575 27.175 5 25.0 31.75 22.775000000000002 20.474999999999998 6 21.2 35.199999999999996 21.349999999999998 22.25 7 14.7 24.85 40.9 19.55 8 17.05 24.349999999999998 30.025000000000002 28.575 9 18.45 21.575 32.75 27.224999999999998 10 19.325 37.225 24.6 18.85 11 22.525000000000002 28.849999999999998 21.85 26.775 12 20.549999999999997 25.8 26.924999999999997 26.724999999999998 13 20.3 28.749999999999996 25.724999999999998 25.224999999999998 14 20.849999999999998 28.575 25.95 24.625 15 21.125 27.900000000000002 25.45 25.525 16 22.25 26.55 25.05 26.150000000000002 17 21.224999999999998 27.075 26.150000000000002 25.55 18 21.075 27.500000000000004 25.75 25.674999999999997 19 22.625 26.924999999999997 24.725 25.724999999999998 20 21.025 27.700000000000003 26.625 24.65 21 20.65 25.6 25.7 28.050000000000004 22 21.349999999999998 26.950000000000003 26.474999999999998 25.224999999999998 23 21.5 26.05 26.55 25.900000000000002 24 22.075 26.775 26.05 25.1 25 20.849999999999998 27.275 25.3 26.575 26 21.7 27.3 24.775 26.224999999999998 27 22.125 26.650000000000002 24.349999999999998 26.875 28 21.75 27.1 25.900000000000002 25.25 29 20.674999999999997 26.85 26.674999999999997 25.8 30 21.175 25.374999999999996 26.674999999999997 26.775 31 22.025 26.700000000000003 25.1 26.174999999999997 32 21.675 27.474999999999998 25.924999999999997 24.925 33 20.75 26.775 26.625 25.85 34 21.875 27.1 25.55 25.474999999999998 35 21.025 26.400000000000002 26.025 26.55 36 20.724999999999998 27.925 24.85 26.5 37 22.575 25.650000000000002 24.55 27.224999999999998 38 21.5 26.450000000000003 25.0 27.05 39 22.375 25.7 25.95 25.974999999999998 40 19.875 27.925 26.275 25.924999999999997 41 21.275 26.525 26.400000000000002 25.8 42 22.1 25.650000000000002 26.1 26.150000000000002 43 21.9 27.650000000000002 25.25 25.2 44 21.675 25.4 26.55 26.375 45 21.6 26.825 26.150000000000002 25.424999999999997 46 22.025 25.85 26.200000000000003 25.924999999999997 47 23.200000000000003 25.674999999999997 25.374999999999996 25.75 48 21.3 27.800000000000004 24.45 26.450000000000003 49 21.4 25.5 26.275 26.825 50 21.45 26.775 24.675 27.1 51 22.55 25.525 25.174999999999997 26.75 52 21.6 26.950000000000003 25.6 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 25.0 1 17.0 2 9.0 3 6.0 4 3.0 5 3.5 6 4.0 7 4.0 8 4.0 9 3.5 10 3.0 11 3.5 12 4.0 13 3.0 14 2.0 15 2.0 16 2.5 17 3.0 18 4.0 19 5.0 20 6.5 21 8.0 22 9.0 23 10.0 24 13.5 25 17.0 26 19.5 27 22.0 28 38.5 29 55.0 30 62.5 31 70.0 32 77.0 33 84.0 34 105.5 35 127.0 36 134.0 37 141.0 38 153.0 39 211.5 40 258.0 41 248.0 42 238.0 43 245.5 44 253.0 45 271.0 46 289.0 47 288.5 48 288.0 49 286.5 50 285.0 51 298.5 52 312.0 53 309.5 54 307.0 55 258.5 56 210.0 57 207.0 58 204.0 59 184.5 60 165.0 61 152.5 62 140.0 63 119.5 64 84.0 65 69.0 66 50.0 67 31.0 68 29.0 69 27.0 70 24.0 71 21.0 72 19.0 73 17.0 74 12.0 75 7.0 76 6.0 77 5.0 78 6.5 79 8.0 80 5.5 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.21565537168374 92.525 2 1.7336485421591805 3.3000000000000003 3 0.5778828473863935 1.6500000000000001 4 0.36774363015497763 1.4000000000000001 5 0.026267402153926978 0.125 6 0.026267402153926978 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026267402153926978 0.22499999999999998 >10 0.026267402153926978 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 25 0.625 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 9 0.22499999999999998 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 6 0.15 No Hit GCTCCATTTGCTAGCTTCACGGATAATTTCATTACCCTCACGAGCAAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra Read 200000 spots for SRR5423354.sra Written 200000 spots for SRR5423354.sra SRR ids: ['SRR5423354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l_2qbsxr SRR5423354.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423354 file size 703995 SRR5423354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423354 SRR5423354_1.fastq Input file: SRR5423354_1.fastq trimmed: SRR5423354-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:36:37 2025 >> started Wed Feb 12 23:45:08 2025 >> done (510.993s) 4000000 reads processed; of these: 133 ( 0.00%) short reads filtered out after trimming by size control 2747 ( 0.07%) empty reads filtered out after trimming by size control 3997120 (99.93%) reads available; of these: 116386 ( 2.91%) trimmed reads available after processing 3880734 (97.09%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 5 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 16 0.00% 27 5 0.00% 28 11 0.00% 29 12 0.00% 30 14 0.00% 31 18 0.00% 32 30 0.00% 33 34 0.00% 34 60 0.00% 35 70 0.00% 36 62 0.00% 37 66 0.00% 38 104 0.00% 39 145 0.00% 40 169 0.00% 41 200 0.01% 42 278 0.01% 43 353 0.01% 44 473 0.01% 45 690 0.02% 46 983 0.02% 47 1647 0.04% 48 2771 0.07% 49 5662 0.14% 50 15056 0.38% 51 87425 2.19% 52 3880734 97.09% 3997120 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=19 prefix-density=1.00 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=10.51 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=CCATCATCCAATCCACGAATGAAACCTGGCGAAAAAGAAGTTCACACTTTCTGGCGACGTCTTTCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTTCGCCTT Started job on | Feb 12 23:48:06 Started mapping on | Feb 12 23:48:09 Finished on | Feb 13 00:04:52 Mapping speed, Million of reads per hour | 14.35 Number of input reads | 3997120 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3270858 Uniquely mapped reads % | 81.83% Average mapped length | 51.74 Number of splices: Total | 298278 Number of splices: Annotated (sjdb) | 292586 Number of splices: GT/AG | 290586 Number of splices: GC/AG | 5923 Number of splices: AT/AC | 509 Number of splices: Non-canonical | 1260 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430985 % of reads mapped to multiple loci | 10.78% Number of reads mapped to too many loci | 141624 % of reads mapped to too many loci | 3.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295277 295277 295277 N_multimapping 430985 430985 430985 N_noFeature 600822 3150519 712391 N_ambiguous 18201 141 9307 UnstrandedReadsAssigned:2651835 PositiveStrandReadsAssigned:120198 NegativeStrandReadsAssigned:2549160 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423354 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423354-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,120 reads, 2,825,313 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR5423354.ke.tsv 34699 SRR5423354.se.tsv 87100 total ==> SRR5423354.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 309.829 58.8483 Potri.005G024800.1.v4.1 1035 936 23 8.95653 Potri.004G059700.1.v4.1 961 862 3 1.26853 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 84.3551 10.8111 Potri.016G087400.1.v4.1 270 171 19 40.4991 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22.887 4.98335 Potri.012G127500.1.v4.1 977 878 125 51.8923 ==> SRR5423354.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 50 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423354 completed mapping pipeline successfully