Starting /dee2/code/volunteer_pipeline.sh SRR5423355 current disk space = 3050504937472 free memory = 1575652640 SRR5423355 SRAfilesize 8f4096e065355dfa9afe83ca66212342 SRR5423355.sra SRR5423355.sra file validated SRR5423355 is single end SRR5423355 is conventional basespace SRR5423355 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.861 31.0 31.0 34.0 30.0 34.0 2 31.92275 33.0 31.0 34.0 30.0 34.0 3 32.09525 34.0 31.0 34.0 30.0 34.0 4 35.1215 37.0 35.0 37.0 32.0 37.0 5 35.31 37.0 35.0 37.0 32.0 37.0 6 35.374 37.0 35.0 37.0 33.0 37.0 7 35.5465 37.0 35.0 37.0 33.0 37.0 8 35.60375 37.0 35.0 37.0 33.0 37.0 9 37.2945 39.0 37.0 39.0 34.0 39.0 10 37.109 39.0 37.0 39.0 33.0 39.0 11 37.09075 39.0 37.0 39.0 33.0 39.0 12 37.29525 39.0 37.0 39.0 34.0 39.0 13 37.18075 39.0 37.0 39.0 33.0 39.0 14 38.42325 40.0 38.0 41.0 33.0 41.0 15 38.43575 40.0 38.0 41.0 33.0 41.0 16 38.4705 40.0 38.0 41.0 34.0 41.0 17 38.278 40.0 38.0 41.0 33.0 41.0 18 38.201 40.0 37.0 41.0 33.0 41.0 19 38.38225 40.0 38.0 41.0 34.0 41.0 20 38.35375 40.0 38.0 41.0 34.0 41.0 21 38.24725 40.0 38.0 41.0 33.0 41.0 22 38.23075 40.0 38.0 41.0 33.0 41.0 23 38.234 40.0 38.0 41.0 33.0 41.0 24 38.084 40.0 37.0 41.0 33.0 41.0 25 38.1825 40.0 38.0 41.0 33.0 41.0 26 38.01525 40.0 37.0 41.0 33.0 41.0 27 37.99675 40.0 37.0 41.0 33.0 41.0 28 37.915 40.0 37.0 41.0 33.0 41.0 29 37.8065 40.0 37.0 41.0 33.0 41.0 30 37.65875 40.0 37.0 41.0 32.0 41.0 31 36.84925 39.0 36.0 41.0 30.0 41.0 32 37.18325 39.0 36.0 41.0 31.0 41.0 33 37.28975 40.0 36.0 41.0 31.0 41.0 34 37.38175 40.0 36.0 41.0 31.0 41.0 35 37.72775 40.0 37.0 41.0 32.0 41.0 36 37.622 40.0 37.0 41.0 32.0 41.0 37 37.476 40.0 37.0 41.0 31.0 41.0 38 37.513 40.0 37.0 41.0 32.0 41.0 39 37.30775 40.0 36.0 41.0 31.0 41.0 40 37.23475 40.0 36.0 41.0 31.0 41.0 41 37.2135 40.0 36.0 41.0 31.0 41.0 42 37.25925 39.0 36.0 41.0 31.0 41.0 43 37.23575 39.0 36.0 41.0 31.0 41.0 44 37.05375 39.0 36.0 41.0 30.0 41.0 45 36.90775 39.0 35.0 41.0 30.0 41.0 46 36.926 39.0 35.0 41.0 30.0 41.0 47 36.566 39.0 35.0 41.0 30.0 41.0 48 36.79275 39.0 35.0 41.0 30.0 41.0 49 36.9295 39.0 35.0 41.0 31.0 41.0 50 36.774 39.0 35.0 41.0 30.0 41.0 51 36.72975 39.0 35.0 41.0 30.0 41.0 52 35.33625 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 3.0 23 6.0 24 12.0 25 11.0 26 20.0 27 25.0 28 29.0 29 55.0 30 70.0 31 101.0 32 138.0 33 156.0 34 178.0 35 273.0 36 355.0 37 474.0 38 709.0 39 1367.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.86788668839308 13.035848583604913 5.916269741789923 38.17999498621209 2 20.525 14.674999999999999 35.85 28.95 3 19.425 19.2 25.05 36.325 4 23.25 26.6 22.35 27.800000000000004 5 24.65 32.625 21.075 21.65 6 20.375 33.925 23.025000000000002 22.675 7 15.125 25.474999999999998 40.425 18.975 8 17.424999999999997 23.225 30.7 28.65 9 18.4 22.7 33.7 25.2 10 20.65 36.4 23.65 19.3 11 22.325 29.45 20.974999999999998 27.250000000000004 12 21.25 23.75 28.225 26.775 13 20.4 27.400000000000002 27.0 25.2 14 20.875 28.925 25.900000000000002 24.3 15 20.849999999999998 27.35 25.275 26.525 16 20.3 27.525 26.575 25.6 17 21.325 26.6 25.575 26.5 18 21.45 27.474999999999998 24.65 26.424999999999997 19 20.775 27.450000000000003 25.924999999999997 25.85 20 20.549999999999997 27.275 26.325 25.85 21 20.375 26.775 26.650000000000002 26.200000000000003 22 21.7 27.900000000000002 25.074999999999996 25.324999999999996 23 21.725 26.8 25.6 25.874999999999996 24 20.7 26.825 26.974999999999998 25.5 25 20.599999999999998 27.1 26.174999999999997 26.125 26 22.45 26.200000000000003 25.924999999999997 25.424999999999997 27 21.425 26.8 25.3 26.474999999999998 28 21.9 27.525 26.85 23.724999999999998 29 21.85 26.275 26.1 25.775 30 21.2 25.8 26.625 26.375 31 22.075 26.825 25.75 25.35 32 21.7 27.224999999999998 25.424999999999997 25.650000000000002 33 22.15 25.900000000000002 25.674999999999997 26.275 34 20.95 27.05 26.174999999999997 25.825 35 21.825 25.575 25.275 27.325 36 21.025 26.625 25.324999999999996 27.025 37 20.974999999999998 27.875 24.7 26.450000000000003 38 21.4 27.275 24.775 26.55 39 21.425 26.05 25.525 27.0 40 20.325 26.400000000000002 26.424999999999997 26.85 41 21.525 27.3 25.525 25.650000000000002 42 21.9 25.025 26.85 26.224999999999998 43 22.0 25.6 25.874999999999996 26.525 44 20.875 26.825 25.7 26.6 45 22.2 25.35 25.775 26.674999999999997 46 21.45 25.650000000000002 26.35 26.55 47 21.260630315157577 27.538769384692348 26.663331665832917 24.537268634317158 48 19.959979989995 26.713356678339167 26.738369184592298 26.588294147073537 49 23.25 25.775 23.425 27.55 50 20.01000500250125 26.563281640820406 25.287643821910955 28.139069534767387 51 20.96048024012006 26.063031515757878 23.81190595297649 29.164582291145575 52 21.860930465232617 27.463731865932967 23.761880940470235 26.91345672836418 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 28.0 1 21.0 2 14.0 3 10.5 4 7.0 5 3.5 6 0.0 7 1.0 8 2.0 9 2.5 10 3.0 11 4.0 12 5.0 13 3.5 14 1.5 15 1.0 16 1.5 17 2.0 18 3.5 19 5.0 20 6.5 21 8.0 22 11.5 23 15.0 24 14.5 25 14.0 26 19.5 27 25.0 28 34.0 29 43.0 30 50.0 31 57.0 32 73.5 33 90.0 34 110.5 35 131.0 36 139.0 37 147.0 38 166.0 39 202.0 40 219.0 41 230.0 42 241.0 43 255.5 44 270.0 45 277.0 46 284.0 47 276.5 48 269.0 49 272.0 50 275.0 51 289.5 52 304.0 53 292.5 54 281.0 55 267.5 56 254.0 57 231.5 58 209.0 59 199.5 60 190.0 61 167.0 62 144.0 63 124.5 64 87.0 65 69.0 66 48.5 67 28.0 68 26.0 69 24.0 70 20.5 71 17.0 72 14.5 73 12.0 74 10.0 75 8.0 76 6.5 77 5.0 78 4.0 79 3.0 80 3.5 81 4.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.05 48 0.05 49 0.0 50 0.05 51 0.05 52 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.57915672235481 91.05 2 2.360116679925749 4.45 3 0.5303632988597189 1.5 4 0.26518164942985945 1.0 5 0.21214531954388757 1.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05303632988597189 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 27 0.675 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 13 0.325 No Hit CTCACGAGCAAGATCACGTCCCTCATTACGAGCTTGTACACATGCTTCTAGA 5 0.125 No Hit GCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 5 0.125 No Hit GCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCT 5 0.125 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCAC 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 5 0.125 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra Read 200000 spots for SRR5423355.sra Written 200000 spots for SRR5423355.sra SRR ids: ['SRR5423355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4l358qvj SRR5423355.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423355 file size 703956 SRR5423355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423355 SRR5423355_1.fastq Input file: SRR5423355_1.fastq trimmed: SRR5423355-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 23:28:20 2025 >> started Wed Feb 12 23:32:26 2025 >> done (245.767s) 4000000 reads processed; of these: 140 ( 0.00%) short reads filtered out after trimming by size control 2806 ( 0.07%) empty reads filtered out after trimming by size control 3997054 (99.93%) reads available; of these: 106697 ( 2.67%) trimmed reads available after processing 3890357 (97.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 7 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 7 0.00% 25 9 0.00% 26 5 0.00% 27 10 0.00% 28 13 0.00% 29 12 0.00% 30 10 0.00% 31 12 0.00% 32 25 0.00% 33 29 0.00% 34 45 0.00% 35 56 0.00% 36 51 0.00% 37 66 0.00% 38 85 0.00% 39 101 0.00% 40 144 0.00% 41 187 0.00% 42 245 0.01% 43 287 0.01% 44 400 0.01% 45 592 0.01% 46 859 0.02% 47 1446 0.04% 48 2337 0.06% 49 4967 0.12% 50 13302 0.33% 51 81366 2.04% 52 3890357 97.33% 3997054 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=20.77 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 12 23:34:45 Started mapping on | Feb 12 23:34:55 Finished on | Feb 12 23:44:20 Mapping speed, Million of reads per hour | 25.47 Number of input reads | 3997054 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3273161 Uniquely mapped reads % | 81.89% Average mapped length | 51.75 Number of splices: Total | 299182 Number of splices: Annotated (sjdb) | 293301 Number of splices: GT/AG | 291657 Number of splices: GC/AG | 5824 Number of splices: AT/AC | 469 Number of splices: Non-canonical | 1232 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429194 % of reads mapped to multiple loci | 10.74% Number of reads mapped to too many loci | 144019 % of reads mapped to too many loci | 3.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 294699 294699 294699 N_multimapping 429194 429194 429194 N_noFeature 602490 3152223 714599 N_ambiguous 18368 122 9428 UnstrandedReadsAssigned:2652303 PositiveStrandReadsAssigned:120816 NegativeStrandReadsAssigned:2549134 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423355 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423355-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,054 reads, 2,850,087 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR5423355.ke.tsv 34699 SRR5423355.se.tsv 87100 total ==> SRR5423355.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 297 55.8563 Potri.005G024800.1.v4.1 1035 936 25 9.6395 Potri.004G059700.1.v4.1 961 862 1 0.418681 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 64.0859 8.13248 Potri.016G087400.1.v4.1 270 171 19 40.1003 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20.9202 4.51026 Potri.012G127500.1.v4.1 977 878 116 47.6819 ==> SRR5423355.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423355 completed mapping pipeline successfully