Starting /dee2/code/volunteer_pipeline.sh SRR5423356 current disk space = 3050830815232 free memory = 1574936944 SRR5423356 SRAfilesize 95ac32b794de973d992912a30b3a67c8 SRR5423356.sra SRR5423356.sra file validated SRR5423356 is single end SRR5423356 is conventional basespace SRR5423356 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.091 34.0 31.0 34.0 30.0 34.0 2 32.1965 34.0 31.0 34.0 30.0 34.0 3 32.304 34.0 31.0 34.0 30.0 34.0 4 35.74125 37.0 35.0 37.0 33.0 37.0 5 35.794 37.0 35.0 37.0 33.0 37.0 6 35.754 37.0 35.0 37.0 35.0 37.0 7 35.775 37.0 35.0 37.0 35.0 37.0 8 35.77725 37.0 35.0 37.0 35.0 37.0 9 37.441 39.0 37.0 39.0 34.0 39.0 10 37.34175 39.0 37.0 39.0 34.0 39.0 11 37.42525 39.0 37.0 39.0 35.0 39.0 12 37.42375 39.0 37.0 39.0 34.0 39.0 13 37.39125 39.0 37.0 39.0 34.0 39.0 14 38.73225 40.0 38.0 41.0 34.0 41.0 15 38.75925 40.0 38.0 41.0 34.0 41.0 16 38.6755 40.0 38.0 41.0 34.0 41.0 17 38.53725 40.0 38.0 41.0 34.0 41.0 18 38.623 40.0 38.0 41.0 34.0 41.0 19 38.5855 40.0 38.0 41.0 34.0 41.0 20 38.5175 40.0 38.0 41.0 34.0 41.0 21 38.593 40.0 38.0 41.0 34.0 41.0 22 38.59075 40.0 38.0 41.0 34.0 41.0 23 38.63075 40.0 38.0 41.0 34.0 41.0 24 38.40325 40.0 38.0 41.0 34.0 41.0 25 38.34575 40.0 38.0 41.0 34.0 41.0 26 38.365 40.0 38.0 41.0 34.0 41.0 27 38.24125 40.0 38.0 41.0 33.0 41.0 28 38.18225 40.0 38.0 41.0 33.0 41.0 29 38.19975 40.0 38.0 41.0 33.0 41.0 30 38.31075 40.0 38.0 41.0 34.0 41.0 31 38.09925 40.0 38.0 41.0 33.0 41.0 32 38.10225 40.0 38.0 41.0 33.0 41.0 33 37.923 40.0 37.0 41.0 33.0 41.0 34 37.82725 40.0 37.0 41.0 33.0 41.0 35 37.93025 40.0 37.0 41.0 33.0 41.0 36 37.71825 40.0 37.0 41.0 32.0 41.0 37 37.64225 40.0 37.0 41.0 32.0 41.0 38 37.6035 40.0 37.0 41.0 31.0 41.0 39 37.63025 40.0 37.0 41.0 32.0 41.0 40 37.55825 40.0 37.0 41.0 32.0 41.0 41 37.57975 40.0 37.0 41.0 32.0 41.0 42 37.57225 40.0 37.0 41.0 32.0 41.0 43 37.32 40.0 36.0 41.0 31.0 41.0 44 37.138 40.0 36.0 41.0 31.0 41.0 45 37.0115 39.0 36.0 41.0 31.0 41.0 46 37.04425 39.0 36.0 41.0 30.0 41.0 47 36.8985 39.0 35.0 41.0 30.0 41.0 48 36.8365 39.0 35.0 41.0 30.0 41.0 49 36.665 39.0 35.0 41.0 30.0 41.0 50 36.68325 39.0 35.0 41.0 30.0 41.0 51 36.685 39.0 35.0 41.0 30.0 41.0 52 35.33175 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1307 1 0.0 1307 2 0.0 1307 3 0.0 1307 4 0.0 1307 5 0.0 1307 6 0.0 1307 7 0.0 1307 8 0.0 1307 9 0.0 1307 10 0.0 1307 11 0.0 1307 12 0.0 1307 13 0.0 1307 14 0.0 1307 15 0.0 1307 16 0.0 1307 17 0.0 1307 18 0.0 1307 19 0.0 1307 20 0.0 1307 21 0.0 1307 22 0.0 1307 23 0.0 1307 24 0.0 1307 25 0.0 1307 26 0.0 1307 27 0.0 1307 28 0.0 1307 29 0.0 1307 30 0.0 1307 31 0.0 1307 32 0.0 1307 33 0.0 1307 34 0.0 1307 35 0.0 1307 36 0.0 1307 37 0.0 1307 38 0.0 1307 39 0.0 1307 40 0.0 1307 41 0.0 1307 42 0.0 1307 43 0.0 1307 44 0.0 1307 45 0.0 1307 46 0.0 1307 47 0.0 1307 48 0.0 1307 49 0.0 1307 50 0.0 1307 51 0.0 1307 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 0.0 22 5.0 23 7.0 24 5.0 25 10.0 26 18.0 27 14.0 28 41.0 29 44.0 30 70.0 31 67.0 32 120.0 33 137.0 34 171.0 35 249.0 36 317.0 37 440.0 38 726.0 39 1548.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.635408852213054 12.353088272068018 5.501375343835959 40.51012753188297 2 20.825 13.775 36.4 28.999999999999996 3 20.3 17.375 25.174999999999997 37.15 4 23.9 26.924999999999997 21.925 27.250000000000004 5 26.3 30.325000000000003 21.8 21.575 6 20.424999999999997 34.050000000000004 23.5 22.025 7 15.7 24.925 40.775 18.6 8 17.2 23.9 30.075000000000003 28.825 9 18.25 22.3 31.1 28.349999999999998 10 18.925 37.175000000000004 24.925 18.975 11 22.325 28.775000000000002 21.4 27.500000000000004 12 21.349999999999998 25.025 26.8 26.825 13 19.05 27.55 27.3 26.1 14 20.0 27.05 27.175 25.775 15 21.275 26.3 25.5 26.924999999999997 16 20.200000000000003 27.575 26.974999999999998 25.25 17 22.7 26.55 25.825 24.925 18 21.625 27.575 24.925 25.874999999999996 19 21.075 26.825 26.35 25.75 20 21.625 26.424999999999997 26.55 25.4 21 20.674999999999997 25.45 26.700000000000003 27.175 22 21.675 27.250000000000004 25.900000000000002 25.174999999999997 23 21.9 28.299999999999997 24.725 25.074999999999996 24 21.675 26.0 26.424999999999997 25.900000000000002 25 22.45 27.224999999999998 24.425 25.900000000000002 26 22.5 26.200000000000003 25.275 26.025 27 21.3 26.674999999999997 25.924999999999997 26.1 28 22.650000000000002 27.700000000000003 25.7 23.95 29 22.025 27.325 25.8 24.85 30 21.5 24.6 26.400000000000002 27.500000000000004 31 21.325 27.474999999999998 24.825 26.375 32 22.7 25.6 24.925 26.775 33 21.6 25.775 25.95 26.674999999999997 34 22.275 26.450000000000003 25.8 25.474999999999998 35 21.4 26.6 24.925 27.075 36 21.325 25.900000000000002 26.150000000000002 26.625 37 22.35 25.8 25.174999999999997 26.674999999999997 38 21.175 27.575 24.95 26.3 39 21.65 25.424999999999997 25.474999999999998 27.450000000000003 40 21.725 27.675 25.275 25.324999999999996 41 22.025 26.55 26.3 25.124999999999996 42 20.9 25.3 25.650000000000002 28.15 43 21.6 26.55 25.6 26.25 44 22.075 26.150000000000002 25.75 26.025 45 22.416812609457093 25.01876407305479 25.093820365273956 27.47060295221416 46 22.491868901676256 26.494871153365025 24.293219914936202 26.720040030022517 47 23.317488116087066 26.54490868151113 25.64423317488116 24.49337002752064 48 22.75 24.95 25.900000000000002 26.400000000000002 49 21.45 26.325 24.075 28.15 50 23.14235676757568 26.46985238929197 24.293219914936202 26.09457092819615 51 20.549999999999997 26.450000000000003 25.575 27.425 52 22.725 26.6 24.75 25.924999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 17.0 1 10.0 2 3.0 3 3.0 4 3.0 5 2.5 6 2.0 7 3.0 8 4.0 9 4.0 10 4.0 11 3.0 12 2.0 13 2.5 14 2.0 15 1.0 16 0.5 17 0.0 18 2.5 19 5.0 20 6.5 21 8.0 22 11.5 23 15.0 24 16.0 25 17.0 26 21.0 27 25.0 28 37.5 29 50.0 30 57.0 31 64.0 32 76.5 33 89.0 34 95.0 35 101.0 36 122.5 37 144.0 38 154.5 39 189.5 40 214.0 41 221.5 42 229.0 43 270.0 44 311.0 45 292.0 46 273.0 47 275.5 48 278.0 49 292.0 50 306.0 51 311.5 52 317.0 53 303.5 54 290.0 55 262.5 56 235.0 57 224.5 58 214.0 59 198.0 60 182.0 61 159.5 62 137.0 63 119.5 64 89.0 65 76.0 66 53.5 67 31.0 68 31.5 69 32.0 70 27.0 71 22.0 72 18.0 73 14.0 74 9.0 75 4.0 76 2.5 77 1.0 78 2.5 79 4.0 80 3.0 81 2.0 82 2.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.075 46 0.075 47 0.075 48 0.0 49 0.0 50 0.075 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.20488322717623 90.625 2 2.680467091295117 5.050000000000001 3 0.5307855626326964 1.5 4 0.3184713375796179 1.2 5 0.18577494692144375 0.8750000000000001 6 0.02653927813163482 0.15 7 0.02653927813163482 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02653927813163482 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 17 0.42500000000000004 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 7 0.17500000000000002 No Hit GTTCTGTTCAAAAACCTCGTCCGAGAACTTGTCTAGAGAAGGATTTCCCGCT 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit GTCGGCTTGAGTAACGCAAACATTGGTGAGAATCCAATGCCCCGAAAACCCA 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCG 5 0.125 TruSeq Adapter, Index 12 (100% over 52bp) GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit GCCTGTAATACCCAGTAACTGGATCAGGAGCCCATGCAGAGTAGGCCTCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra Read 200000 spots for SRR5423356.sra Written 200000 spots for SRR5423356.sra SRR ids: ['SRR5423356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fw16ebkx SRR5423356.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423356 file size 703940 SRR5423356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423356 SRR5423356_1.fastq Input file: SRR5423356_1.fastq trimmed: SRR5423356-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:15:55 2025 >> started Thu Feb 13 00:20:17 2025 >> done (261.984s) 4000000 reads processed; of these: 141 ( 0.00%) short reads filtered out after trimming by size control 2798 ( 0.07%) empty reads filtered out after trimming by size control 3997061 (99.93%) reads available; of these: 99653 ( 2.49%) trimmed reads available after processing 3897408 (97.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 9 0.00% 28 10 0.00% 29 15 0.00% 30 12 0.00% 31 15 0.00% 32 20 0.00% 33 28 0.00% 34 36 0.00% 35 28 0.00% 36 28 0.00% 37 47 0.00% 38 57 0.00% 39 87 0.00% 40 116 0.00% 41 154 0.00% 42 205 0.01% 43 270 0.01% 44 327 0.01% 45 499 0.01% 46 692 0.02% 47 1181 0.03% 48 2074 0.05% 49 4356 0.11% 50 12321 0.31% 51 77030 1.93% 52 3897408 97.51% 3997061 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=18 prefix-density=0.64 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=18.86 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 13 00:26:24 Started mapping on | Feb 13 00:26:51 Finished on | Feb 13 00:55:37 Mapping speed, Million of reads per hour | 8.34 Number of input reads | 3997061 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3271198 Uniquely mapped reads % | 81.84% Average mapped length | 51.75 Number of splices: Total | 298452 Number of splices: Annotated (sjdb) | 292711 Number of splices: GT/AG | 290724 Number of splices: GC/AG | 5960 Number of splices: AT/AC | 439 Number of splices: Non-canonical | 1329 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431256 % of reads mapped to multiple loci | 10.79% Number of reads mapped to too many loci | 143815 % of reads mapped to too many loci | 3.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 294607 294607 294607 N_multimapping 431256 431256 431256 N_noFeature 602721 3151424 713585 N_ambiguous 18268 144 9234 UnstrandedReadsAssigned:2650209 PositiveStrandReadsAssigned:119630 NegativeStrandReadsAssigned:2548379 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423356 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423356-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,061 reads, 2,845,680 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR5423356.ke.tsv 34699 SRR5423356.se.tsv 87100 total ==> SRR5423356.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 307 57.8278 Potri.005G024800.1.v4.1 1035 936 21 8.10993 Potri.004G059700.1.v4.1 961 862 3 1.25802 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 54.7613 6.96013 Potri.016G087400.1.v4.1 270 171 21 44.3912 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.8192 3.19995 Potri.012G127500.1.v4.1 977 878 128 52.6974 ==> SRR5423356.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 44 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423356 completed mapping pipeline successfully