Starting /dee2/code/volunteer_pipeline.sh SRR5423357 current disk space = 3050850983936 free memory = 1572406352 SRR5423357 SRAfilesize c5ccbbdb924a6527ae0971bf17169f5e SRR5423357.sra SRR5423357.sra file validated SRR5423357 is single end SRR5423357 is conventional basespace SRR5423357 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23425 34.0 31.0 34.0 30.0 34.0 2 32.36975 34.0 31.0 34.0 30.0 34.0 3 32.46775 34.0 31.0 34.0 30.0 34.0 4 35.87125 37.0 35.0 37.0 35.0 37.0 5 35.8 37.0 35.0 37.0 35.0 37.0 6 35.767 37.0 35.0 37.0 35.0 37.0 7 35.789 37.0 35.0 37.0 35.0 37.0 8 35.91425 37.0 35.0 37.0 35.0 37.0 9 37.67975 39.0 37.0 39.0 35.0 39.0 10 37.5575 39.0 37.0 39.0 35.0 39.0 11 37.5265 39.0 37.0 39.0 35.0 39.0 12 37.494 39.0 37.0 39.0 35.0 39.0 13 37.45925 39.0 37.0 39.0 35.0 39.0 14 38.883 40.0 38.0 41.0 35.0 41.0 15 38.91375 40.0 38.0 41.0 35.0 41.0 16 38.9115 40.0 38.0 41.0 35.0 41.0 17 38.67275 40.0 38.0 41.0 34.0 41.0 18 38.753 40.0 38.0 41.0 35.0 41.0 19 38.71025 40.0 38.0 41.0 34.0 41.0 20 38.721 40.0 38.0 41.0 34.0 41.0 21 38.6915 40.0 38.0 41.0 34.0 41.0 22 38.544 40.0 38.0 41.0 34.0 41.0 23 38.50425 40.0 38.0 41.0 34.0 41.0 24 38.543 40.0 38.0 41.0 34.0 41.0 25 38.4415 40.0 38.0 41.0 34.0 41.0 26 38.305 40.0 38.0 41.0 34.0 41.0 27 38.11975 40.0 38.0 41.0 33.0 41.0 28 38.09925 40.0 38.0 41.0 33.0 41.0 29 38.06875 40.0 38.0 41.0 33.0 41.0 30 37.98225 40.0 38.0 41.0 33.0 41.0 31 38.00925 40.0 38.0 41.0 33.0 41.0 32 37.67775 40.0 37.0 41.0 32.0 41.0 33 37.65925 40.0 37.0 41.0 32.0 41.0 34 37.643 40.0 37.0 41.0 32.0 41.0 35 37.571 40.0 37.0 41.0 31.0 41.0 36 37.63725 40.0 37.0 41.0 32.0 41.0 37 37.63625 40.0 37.0 41.0 32.0 41.0 38 37.511 40.0 37.0 41.0 31.0 41.0 39 37.39125 40.0 37.0 41.0 31.0 41.0 40 37.2325 40.0 37.0 41.0 31.0 41.0 41 37.19075 40.0 36.0 41.0 30.0 41.0 42 37.14925 40.0 36.0 41.0 30.0 41.0 43 37.00525 40.0 36.0 41.0 30.0 41.0 44 36.744 40.0 35.0 41.0 30.0 41.0 45 36.69 39.0 35.0 41.0 30.0 41.0 46 36.67075 39.0 35.0 41.0 30.0 41.0 47 36.5765 39.0 35.0 41.0 29.0 41.0 48 36.39325 39.0 35.0 41.0 29.0 41.0 49 36.2615 39.0 35.0 41.0 28.0 41.0 50 36.054 39.0 35.0 41.0 27.0 41.0 51 36.02925 39.0 35.0 40.0 27.0 41.0 52 34.3 38.0 33.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2103 1 0.0 2103 2 0.0 2103 3 0.0 2103 4 0.0 2103 5 0.0 2103 6 0.0 2103 7 0.0 2103 8 0.0 2103 9 0.0 2103 10 0.0 2103 11 0.0 2103 12 0.0 2103 13 0.0 2103 14 0.0 2103 15 0.0 2103 16 0.0 2103 17 0.0 2103 18 0.0 2103 19 0.0 2103 20 0.0 2103 21 0.0 2103 22 0.0 2103 23 0.0 2103 24 0.0 2103 25 0.0 2103 26 0.0 2103 27 0.0 2103 28 0.0 2103 29 0.0 2103 30 0.0 2103 31 0.0 2103 32 0.0 2103 33 0.0 2103 34 0.0 2103 35 0.0 2103 36 0.0 2103 37 0.0 2103 38 0.0 2103 39 0.0 2103 40 0.0 2103 41 0.0 2103 42 0.0 2103 43 0.0 2103 44 0.0 2103 45 0.0 2103 46 0.0 2103 47 0.0 2103 48 0.0 2103 49 0.0 2103 50 0.0 2103 51 0.0 2103 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 1.0 22 4.0 23 4.0 24 17.0 25 11.0 26 24.0 27 29.0 28 37.0 29 49.0 30 61.0 31 98.0 32 98.0 33 133.0 34 162.0 35 251.0 36 275.0 37 446.0 38 763.0 39 1525.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.71256885327992 13.44516775162744 5.633450175262894 39.20881321982975 2 21.15 14.625 34.050000000000004 30.175 3 20.325 17.925 24.725 37.025000000000006 4 22.875 26.950000000000003 23.674999999999997 26.5 5 24.25 30.975 23.400000000000002 21.375 6 21.4 33.900000000000006 22.925 21.775 7 15.325 24.875 41.55 18.25 8 17.1 23.625 30.925000000000004 28.349999999999998 9 18.099999999999998 22.400000000000002 33.5 26.0 10 18.875 37.3 23.75 20.075000000000003 11 23.125 28.299999999999997 22.275 26.3 12 20.65 25.575 27.250000000000004 26.525 13 20.375 28.775000000000002 26.974999999999998 23.875 14 19.75 27.025 27.925 25.3 15 20.75 27.0 27.35 24.9 16 22.5 27.075 24.625 25.8 17 21.825 26.224999999999998 26.400000000000002 25.55 18 21.825 27.275 26.025 24.875 19 21.975 27.950000000000003 25.224999999999998 24.85 20 20.95 25.8 26.75 26.5 21 21.375 25.95 25.55 27.125 22 20.775 27.224999999999998 26.35 25.650000000000002 23 20.8 26.400000000000002 25.575 27.224999999999998 24 20.674999999999997 26.625 25.2 27.500000000000004 25 21.275 27.275 24.425 27.025 26 21.65 26.875 25.825 25.650000000000002 27 21.05 27.700000000000003 25.3 25.95 28 21.475 28.025 25.8 24.7 29 21.275 27.474999999999998 26.6 24.65 30 21.475 25.775 26.974999999999998 25.775 31 23.200000000000003 26.75 24.9 25.15 32 22.575 27.025 25.474999999999998 24.925 33 21.05 25.724999999999998 26.950000000000003 26.275 34 21.25 26.700000000000003 26.125 25.924999999999997 35 20.75 26.150000000000002 25.35 27.750000000000004 36 21.675 26.775 24.525 27.025 37 22.400000000000002 26.325 26.0 25.275 38 22.15 26.075 25.374999999999996 26.400000000000002 39 20.825 26.05 26.8 26.325 40 20.925 27.375 25.2 26.5 41 22.2 26.950000000000003 25.0 25.85 42 21.45 26.275 25.025 27.250000000000004 43 21.5 26.200000000000003 24.85 27.450000000000003 44 22.25 26.125 25.0 26.625 45 21.4 26.8 26.474999999999998 25.324999999999996 46 21.975 26.3 25.275 26.450000000000003 47 22.35 25.025 25.05 27.575 48 21.55 27.125 24.9 26.424999999999997 49 21.85 28.375 23.375 26.400000000000002 50 21.8 25.575 25.6 27.025 51 20.65 25.55 25.2 28.599999999999998 52 22.525000000000002 26.775 25.25 25.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 17.0 1 13.5 2 10.0 3 7.0 4 4.0 5 4.5 6 5.0 7 5.0 8 5.0 9 4.0 10 3.0 11 3.0 12 3.0 13 2.5 14 2.0 15 2.0 16 2.0 17 2.0 18 4.5 19 7.0 20 10.0 21 13.0 22 14.5 23 16.0 24 14.5 25 13.0 26 22.0 27 31.0 28 39.5 29 48.0 30 48.0 31 48.0 32 66.5 33 85.0 34 96.0 35 107.0 36 140.0 37 173.0 38 186.0 39 216.5 40 234.0 41 242.0 42 250.0 43 251.0 44 252.0 45 255.5 46 259.0 47 275.0 48 291.0 49 299.0 50 307.0 51 292.0 52 277.0 53 276.0 54 275.0 55 255.0 56 235.0 57 227.0 58 219.0 59 197.5 60 176.0 61 163.5 62 151.0 63 120.0 64 77.0 65 65.0 66 50.5 67 36.0 68 30.5 69 25.0 70 23.5 71 22.0 72 21.5 73 21.0 74 14.0 75 7.0 76 7.5 77 8.0 78 4.5 79 1.0 80 3.5 81 6.0 82 3.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.11815561959655 92.675 2 1.9386953104532356 3.6999999999999997 3 0.5501702908042966 1.575 4 0.23578726748755569 0.8999999999999999 5 0.10479434110558031 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026198585276395077 0.22499999999999998 >10 0.026198585276395077 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 17 0.42500000000000004 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 9 0.22499999999999998 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GCCAGACTAAGCAATAAAGTACCTCGTATTTTCCCCTCTGCCTCGGGTTGTC 5 0.125 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra Read 200000 spots for SRR5423357.sra Written 200000 spots for SRR5423357.sra SRR ids: ['SRR5423357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_brt2p6b_ SRR5423357.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423357 file size 703999 SRR5423357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423357 SRR5423357_1.fastq Input file: SRR5423357_1.fastq trimmed: SRR5423357-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:16:42 2025 >> started Thu Feb 13 00:26:34 2025 >> done (591.735s) 4000000 reads processed; of these: 127 ( 0.00%) short reads filtered out after trimming by size control 2449 ( 0.06%) empty reads filtered out after trimming by size control 3997424 (99.94%) reads available; of these: 120980 ( 3.03%) trimmed reads available after processing 3876444 (96.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 11 0.00% 31 12 0.00% 32 24 0.00% 33 27 0.00% 34 31 0.00% 35 32 0.00% 36 42 0.00% 37 58 0.00% 38 54 0.00% 39 79 0.00% 40 128 0.00% 41 171 0.00% 42 191 0.00% 43 298 0.01% 44 384 0.01% 45 569 0.01% 46 840 0.02% 47 1395 0.03% 48 2322 0.06% 49 4682 0.12% 50 14403 0.36% 51 95180 2.38% 52 3876444 96.97% 3997424 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=19 prefix-density=1.03 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=20.33 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 13 00:32:37 Started mapping on | Feb 13 00:32:57 Finished on | Feb 13 01:00:53 Mapping speed, Million of reads per hour | 8.59 Number of input reads | 3997424 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3267199 Uniquely mapped reads % | 81.73% Average mapped length | 51.74 Number of splices: Total | 297334 Number of splices: Annotated (sjdb) | 291598 Number of splices: GT/AG | 289912 Number of splices: GC/AG | 5751 Number of splices: AT/AC | 458 Number of splices: Non-canonical | 1213 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431944 % of reads mapped to multiple loci | 10.81% Number of reads mapped to too many loci | 139915 % of reads mapped to too many loci | 3.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298281 298281 298281 N_multimapping 431944 431944 431944 N_noFeature 602152 3147093 713399 N_ambiguous 18191 133 9217 UnstrandedReadsAssigned:2646856 PositiveStrandReadsAssigned:119973 NegativeStrandReadsAssigned:2544583 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423357 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423357-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,424 reads, 2,795,446 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR5423357.ke.tsv 34699 SRR5423357.se.tsv 87100 total ==> SRR5423357.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 311 59.7496 Potri.005G024800.1.v4.1 1035 936 21 8.27166 Potri.004G059700.1.v4.1 961 862 1 0.427703 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.5519 7.8496 Potri.016G087400.1.v4.1 270 171 12 25.8723 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19 4.18454 Potri.012G127500.1.v4.1 977 878 136 57.1076 ==> SRR5423357.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 39 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423357 completed mapping pipeline successfully