Starting /dee2/code/volunteer_pipeline.sh SRR5423358 current disk space = 3050888364032 free memory = 1574259172 SRR5423358 SRAfilesize b9a297cca9ad1c4ed9ef5a08a636a33f SRR5423358.sra SRR5423358.sra file validated SRR5423358 is single end SRR5423358 is conventional basespace SRR5423358 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.029 31.0 30.0 31.0 30.0 34.0 2 31.061 31.0 30.0 31.0 30.0 34.0 3 31.09025 31.0 30.0 33.0 30.0 34.0 4 34.13675 35.0 35.0 37.0 30.0 37.0 5 34.43825 35.0 35.0 37.0 32.0 37.0 6 27.95575 32.0 19.0 35.0 10.0 37.0 7 32.343 35.0 32.0 35.0 27.0 37.0 8 30.3255 35.0 28.0 35.0 16.0 37.0 9 34.858 37.0 34.0 39.0 28.0 39.0 10 29.32475 33.0 25.0 37.0 11.0 39.0 11 33.7595 35.0 32.0 37.0 27.0 39.0 12 34.9695 37.0 34.0 39.0 30.0 39.0 13 35.629 37.0 35.0 39.0 30.0 39.0 14 29.8285 33.0 24.0 38.0 11.0 40.0 15 33.655 36.0 32.0 39.0 24.0 40.0 16 35.22525 37.0 33.0 40.0 27.0 40.0 17 36.6645 38.0 36.0 40.0 32.0 40.0 18 32.24275 36.0 29.0 39.0 15.0 40.0 19 30.868 34.0 26.0 39.0 11.0 40.0 20 34.9495 37.0 32.0 40.0 27.0 40.0 21 32.5535 36.0 30.0 39.0 18.0 40.0 22 35.799 37.0 34.0 40.0 29.0 40.0 23 36.78875 38.0 36.0 40.0 32.0 40.0 24 36.4115 38.0 35.0 40.0 30.0 40.0 25 36.5 38.0 35.0 40.0 30.0 40.0 26 30.66975 36.0 25.0 39.0 10.0 40.0 27 34.60625 37.0 32.0 40.0 25.0 40.0 28 29.41525 34.0 23.0 38.0 10.0 40.0 29 33.87675 36.0 31.0 39.0 25.0 40.0 30 35.57925 37.0 34.0 40.0 29.0 40.0 31 31.49725 36.0 27.0 39.0 10.0 40.0 32 34.7935 37.0 33.0 40.0 25.0 40.0 33 35.46175 37.0 34.0 40.0 27.0 40.0 34 29.0795 34.0 21.0 38.0 9.0 40.0 35 27.03875 30.0 16.0 37.0 9.0 40.0 36 31.7805 34.0 27.0 38.0 16.0 40.0 37 34.5485 37.0 33.0 39.0 25.0 40.0 38 35.1285 37.0 34.0 40.0 27.0 40.0 39 35.41275 37.0 34.0 40.0 27.0 40.0 40 35.9195 38.0 35.0 40.0 29.0 40.0 41 35.9295 38.0 35.0 40.0 29.0 40.0 42 35.71875 38.0 34.0 40.0 29.0 40.0 43 36.127 38.0 35.0 40.0 30.0 41.0 44 35.58975 38.0 34.0 40.0 28.0 40.0 45 35.5705 38.0 34.0 40.0 28.0 40.0 46 35.5795 38.0 34.0 40.0 28.0 40.0 47 35.6665 38.0 34.0 40.0 28.0 40.0 48 35.865 38.0 34.0 40.0 29.0 40.0 49 35.52675 37.0 34.0 40.0 28.0 40.0 50 35.483 38.0 34.0 40.0 28.0 40.0 51 35.63075 37.0 34.0 40.0 28.0 40.0 52 27.89675 33.0 18.0 38.0 8.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2116 1 0.0 2116 2 0.0 2116 3 0.0 2116 4 0.0 2116 5 0.0 2116 6 0.0 2116 7 0.0 2116 8 0.0 2116 9 0.0 2116 10 0.0 2116 11 0.0 2116 12 0.0 2116 13 0.0 2116 14 0.0 2116 15 0.0 2116 16 0.0 2116 17 0.0 2116 18 0.0 2116 19 0.0 2116 20 0.0 2116 21 0.0 2116 22 0.0 2116 23 0.0 2116 24 0.0 2116 25 0.0 2116 26 0.0 2116 27 0.0 2116 28 0.0 2116 29 0.0 2116 30 0.0 2116 31 0.0 2116 32 0.0 2116 33 0.0 2116 34 0.0 2116 35 0.0 2116 36 0.0 2116 37 0.0 2116 38 0.0 2116 39 0.0 2116 40 0.0 2116 41 0.0 2116 42 0.0 2116 43 0.0 2116 44 0.0 2116 45 0.0 2116 46 0.0 2116 47 0.0 2116 48 0.0 2116 49 0.0 2116 50 0.0 2116 51 0.0 2116 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 2.0 19 3.0 20 3.0 21 5.0 22 9.0 23 27.0 24 24.0 25 39.0 26 77.0 27 100.0 28 132.0 29 196.0 30 227.0 31 272.0 32 354.0 33 425.0 34 465.0 35 548.0 36 477.0 37 331.0 38 209.0 39 71.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.26031507876969 14.303575893973495 6.001500375093773 38.434608652163035 2 22.3 15.174999999999999 33.5 29.025000000000002 3 19.275000000000002 19.925 25.3 35.5 4 23.425 27.375 23.075000000000003 26.125 5 24.5 31.55 23.974999999999998 19.975 6 24.725 30.55 25.0 19.725 7 15.25 24.099999999999998 41.525 19.125 8 15.6 23.325000000000003 32.875 28.199999999999996 9 18.05 22.25 34.25 25.45 10 19.075 34.025 29.049999999999997 17.849999999999998 11 22.5 28.825 22.275 26.400000000000002 12 21.75 24.65 28.075 25.525 13 20.150000000000002 28.225 28.050000000000004 23.575 14 20.525 25.95 30.099999999999998 23.425 15 20.625 26.924999999999997 26.8 25.650000000000002 16 20.575 28.225 25.75 25.45 17 21.9 27.0 26.775 24.325 18 20.549999999999997 27.500000000000004 26.775 25.174999999999997 19 17.65 27.224999999999998 30.2 24.925 20 21.85 25.374999999999996 28.275 24.5 21 21.575 26.35 26.3 25.775 22 20.974999999999998 28.050000000000004 26.900000000000002 24.075 23 21.55 27.525 26.025 24.9 24 22.475 26.424999999999997 25.674999999999997 25.424999999999997 25 20.1 27.3 26.6 26.0 26 21.125 26.55 28.325 24.0 27 19.975 27.275 25.874999999999996 26.875 28 19.15 26.525 30.65 23.674999999999997 29 21.175 27.075 27.3 24.45 30 21.85 25.474999999999998 26.5 26.174999999999997 31 23.7 26.55 25.25 24.5 32 22.2 27.3 25.324999999999996 25.174999999999997 33 21.475 26.775 25.525 26.224999999999998 34 17.474999999999998 25.650000000000002 32.725 24.15 35 18.65 25.124999999999996 30.675 25.55 36 21.099999999999998 27.200000000000003 24.875 26.825 37 21.0 26.075 26.05 26.875 38 21.5 26.450000000000003 25.224999999999998 26.825 39 20.775 26.525 26.150000000000002 26.55 40 21.6 28.1 25.025 25.275 41 22.15 26.450000000000003 26.55 24.85 42 22.325 26.35 23.925 27.400000000000002 43 21.875 27.200000000000003 24.75 26.174999999999997 44 21.325 27.35 25.15 26.174999999999997 45 20.65 26.424999999999997 25.55 27.375 46 22.05 24.975 25.95 27.025 47 21.725 25.575 26.424999999999997 26.275 48 20.525 26.6 26.950000000000003 25.924999999999997 49 22.925 27.625 24.825 24.625 50 22.025 26.0 26.625 25.35 51 22.0 26.424999999999997 25.624999999999996 25.95 52 20.1 26.05 28.525 25.324999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 23.0 1 21.0 2 19.0 3 13.0 4 7.0 5 5.0 6 3.0 7 4.5 8 6.0 9 8.0 10 10.0 11 6.0 12 2.0 13 2.0 14 3.0 15 4.0 16 5.0 17 6.0 18 5.5 19 5.0 20 6.0 21 7.0 22 12.0 23 17.0 24 14.0 25 11.0 26 23.0 27 35.0 28 42.5 29 50.0 30 56.5 31 63.0 32 80.5 33 98.0 34 113.0 35 128.0 36 153.5 37 179.0 38 194.5 39 203.0 40 196.0 41 216.0 42 236.0 43 252.0 44 268.0 45 297.5 46 327.0 47 317.0 48 307.0 49 305.0 50 303.0 51 298.0 52 293.0 53 276.5 54 260.0 55 244.5 56 229.0 57 204.0 58 179.0 59 172.0 60 165.0 61 142.0 62 119.0 63 98.5 64 68.0 65 58.0 66 46.0 67 34.0 68 27.0 69 20.0 70 18.5 71 17.0 72 13.5 73 10.0 74 8.0 75 6.0 76 5.0 77 4.0 78 3.5 79 3.0 80 2.5 81 2.0 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26526475804408 97.95 2 0.5827210539650367 1.15 3 0.10134279199391943 0.3 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 20 0.5 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra Read 200000 spots for SRR5423358.sra Written 200000 spots for SRR5423358.sra SRR ids: ['SRR5423358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4mrg_1ti SRR5423358.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423358 file size 703958 SRR5423358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423358 SRR5423358_1.fastq Input file: SRR5423358_1.fastq trimmed: SRR5423358-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:26:51 2025 >> started Thu Feb 13 00:31:42 2025 >> done (290.405s) 4000000 reads processed; of these: 135 ( 0.00%) short reads filtered out after trimming by size control 2913 ( 0.07%) empty reads filtered out after trimming by size control 3996952 (99.92%) reads available; of these: 144338 ( 3.61%) trimmed reads available after processing 3852614 (96.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 8 0.00% 20 5 0.00% 21 1 0.00% 22 5 0.00% 23 8 0.00% 24 6 0.00% 25 8 0.00% 26 11 0.00% 27 8 0.00% 28 12 0.00% 29 16 0.00% 30 26 0.00% 31 22 0.00% 32 30 0.00% 33 52 0.00% 34 72 0.00% 35 65 0.00% 36 82 0.00% 37 81 0.00% 38 104 0.00% 39 154 0.00% 40 201 0.01% 41 242 0.01% 42 348 0.01% 43 433 0.01% 44 601 0.02% 45 833 0.02% 46 1124 0.03% 47 1840 0.05% 48 3206 0.08% 49 6168 0.15% 50 16375 0.41% 51 112177 2.81% 52 3852614 96.39% 3996952 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=20 prefix-density=1.00 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=18.97 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 13 00:36:48 Started mapping on | Feb 13 00:37:06 Finished on | Feb 13 01:00:30 Mapping speed, Million of reads per hour | 10.25 Number of input reads | 3996952 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3270172 Uniquely mapped reads % | 81.82% Average mapped length | 51.73 Number of splices: Total | 298338 Number of splices: Annotated (sjdb) | 292679 Number of splices: GT/AG | 290610 Number of splices: GC/AG | 6065 Number of splices: AT/AC | 465 Number of splices: Non-canonical | 1198 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430088 % of reads mapped to multiple loci | 10.76% Number of reads mapped to too many loci | 141603 % of reads mapped to too many loci | 3.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296692 296692 296692 N_multimapping 430088 430088 430088 N_noFeature 598686 3149353 710671 N_ambiguous 18059 127 9116 UnstrandedReadsAssigned:2653427 PositiveStrandReadsAssigned:120692 NegativeStrandReadsAssigned:2550385 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423358 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423358-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,996,952 reads, 2,815,179 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR5423358.ke.tsv 34699 SRR5423358.se.tsv 87100 total ==> SRR5423358.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 315 60.0691 Potri.005G024800.1.v4.1 1035 936 25 9.77417 Potri.004G059700.1.v4.1 961 862 5 2.12265 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 56.8288 7.31231 Potri.016G087400.1.v4.1 270 171 13.5371 28.9698 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 3.93489 Potri.012G127500.1.v4.1 977 878 162 67.5206 ==> SRR5423358.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 44 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423358 completed mapping pipeline successfully