Starting /dee2/code/volunteer_pipeline.sh SRR5423359 current disk space = 3050900230144 free memory = 1577974884 SRR5423359 SRAfilesize 812d5c348bc2f67cdd2e87f68c5e2ef3 SRR5423359.sra SRR5423359.sra file validated SRR5423359 is single end SRR5423359 is conventional basespace SRR5423359 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27775 31.0 31.0 34.0 28.0 34.0 2 31.43925 31.0 31.0 34.0 28.0 34.0 3 31.76625 31.0 31.0 34.0 30.0 34.0 4 33.549 35.0 33.0 37.0 26.0 37.0 5 34.97125 37.0 35.0 37.0 32.0 37.0 6 35.25925 37.0 35.0 37.0 32.0 37.0 7 35.30175 37.0 35.0 37.0 32.0 37.0 8 35.5035 37.0 35.0 37.0 33.0 37.0 9 36.8035 39.0 37.0 39.0 32.0 39.0 10 37.0765 39.0 37.0 39.0 33.0 39.0 11 36.95375 39.0 37.0 39.0 33.0 39.0 12 36.853 39.0 37.0 39.0 32.0 39.0 13 36.91675 39.0 37.0 39.0 33.0 39.0 14 38.372 40.0 38.0 41.0 34.0 41.0 15 38.19225 40.0 37.0 41.0 33.0 41.0 16 38.20625 40.0 37.0 41.0 33.0 41.0 17 38.12775 40.0 38.0 41.0 33.0 41.0 18 38.06375 40.0 37.0 41.0 33.0 41.0 19 38.1415 40.0 37.0 41.0 33.0 41.0 20 37.98575 40.0 37.0 41.0 33.0 41.0 21 38.22125 40.0 37.0 41.0 33.0 41.0 22 38.053 40.0 37.0 41.0 33.0 41.0 23 37.9915 40.0 37.0 41.0 33.0 41.0 24 38.054 40.0 37.0 41.0 33.0 41.0 25 37.91175 40.0 37.0 41.0 33.0 41.0 26 37.71375 40.0 37.0 41.0 32.0 41.0 27 37.682 40.0 37.0 41.0 32.0 41.0 28 37.716 40.0 37.0 41.0 33.0 41.0 29 37.72925 40.0 37.0 41.0 32.0 41.0 30 37.805 40.0 37.0 41.0 33.0 41.0 31 37.488 40.0 37.0 41.0 31.0 41.0 32 37.635 40.0 37.0 41.0 32.0 41.0 33 37.59 40.0 37.0 41.0 32.0 41.0 34 37.3745 39.0 36.0 41.0 31.0 41.0 35 37.338 39.0 36.0 41.0 31.0 41.0 36 37.49325 39.0 36.0 41.0 32.0 41.0 37 37.34925 40.0 36.0 41.0 31.0 41.0 38 37.1315 39.0 36.0 41.0 31.0 41.0 39 37.14125 39.0 36.0 41.0 31.0 41.0 40 37.02525 39.0 36.0 41.0 30.0 41.0 41 36.747 39.0 35.0 40.0 30.0 41.0 42 36.6915 39.0 35.0 41.0 30.0 41.0 43 36.76925 39.0 35.0 40.0 30.0 41.0 44 36.702 39.0 35.0 40.0 30.0 41.0 45 36.523 39.0 35.0 40.0 30.0 41.0 46 36.57025 39.0 35.0 40.0 30.0 41.0 47 36.55325 39.0 35.0 40.0 30.0 41.0 48 36.6165 39.0 35.0 40.0 30.0 41.0 49 36.628 39.0 35.0 40.0 30.0 41.0 50 36.4175 39.0 35.0 40.0 30.0 41.0 51 36.35725 39.0 35.0 40.0 30.0 41.0 52 35.493 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2213 1 0.0 2213 2 0.0 2213 3 0.0 2213 4 0.0 2213 5 0.0 2213 6 0.0 2213 7 0.0 2213 8 0.0 2213 9 0.0 2213 10 0.0 2213 11 0.0 2213 12 0.0 2213 13 0.0 2213 14 0.0 2213 15 0.0 2213 16 0.0 2213 17 0.0 2213 18 0.0 2213 19 0.0 2213 20 0.0 2213 21 0.0 2213 22 0.0 2213 23 0.0 2213 24 0.0 2213 25 0.0 2213 26 0.0 2213 27 0.0 2213 28 0.0 2213 29 0.0 2213 30 0.0 2213 31 0.0 2213 32 0.0 2213 33 0.0 2213 34 0.0 2213 35 0.0 2213 36 0.0 2213 37 0.0 2213 38 0.0 2213 39 0.0 2213 40 0.0 2213 41 0.0 2213 42 0.0 2213 43 0.0 2213 44 0.0 2213 45 0.0 2213 46 0.0 2213 47 0.0 2213 48 0.0 2213 49 0.0 2213 50 0.0 2213 51 0.0 2213 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 1.0 22 2.0 23 6.0 24 11.0 25 11.0 26 23.0 27 39.0 28 43.0 29 50.0 30 60.0 31 105.0 32 124.0 33 182.0 34 228.0 35 292.0 36 405.0 37 519.0 38 751.0 39 1134.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.40601503759399 13.107769423558896 5.488721804511278 38.99749373433584 2 21.45 15.125 34.525 28.9 3 19.975 17.825 25.25 36.95 4 23.05 25.3 24.15 27.500000000000004 5 23.849999999999998 32.925 21.85 21.375 6 20.775 34.675 22.650000000000002 21.9 7 14.575 24.0 41.65 19.775000000000002 8 17.825 22.975 31.0 28.199999999999996 9 16.925 22.5 33.675 26.900000000000002 10 18.75 38.125 24.275 18.85 11 22.2 28.7 22.1 27.0 12 21.099999999999998 24.575 27.400000000000002 26.924999999999997 13 19.45 28.349999999999998 28.325 23.875 14 18.025 27.900000000000002 27.425 26.650000000000002 15 19.2 27.500000000000004 26.575 26.724999999999998 16 20.95 27.450000000000003 26.400000000000002 25.2 17 21.099999999999998 27.150000000000002 25.75 26.0 18 21.7 26.674999999999997 25.55 26.075 19 20.05 27.150000000000002 25.825 26.974999999999998 20 20.825 26.825 27.025 25.324999999999996 21 20.275000000000002 27.05 27.025 25.650000000000002 22 20.150000000000002 26.825 26.700000000000003 26.325 23 21.375 27.575 25.374999999999996 25.674999999999997 24 20.849999999999998 27.250000000000004 25.374999999999996 26.525 25 19.650000000000002 28.499999999999996 25.25 26.6 26 21.15 26.150000000000002 26.8 25.900000000000002 27 21.55 27.025 26.375 25.05 28 21.349999999999998 26.825 26.05 25.775 29 20.9 27.450000000000003 26.450000000000003 25.2 30 21.525 27.075 24.925 26.474999999999998 31 20.925 27.250000000000004 26.724999999999998 25.1 32 20.724999999999998 28.499999999999996 25.2 25.575 33 21.925 25.224999999999998 26.325 26.525 34 21.925 27.250000000000004 24.425 26.400000000000002 35 21.15 25.2 26.5 27.150000000000002 36 20.575 26.724999999999998 24.349999999999998 28.349999999999998 37 22.375 26.924999999999997 25.05 25.650000000000002 38 21.5 26.650000000000002 25.3 26.55 39 21.2 26.375 25.5 26.924999999999997 40 20.45 28.425 25.95 25.174999999999997 41 22.225 26.224999999999998 25.8 25.75 42 21.575 25.25 25.974999999999998 27.200000000000003 43 21.275 26.075 26.075 26.575 44 22.35 25.2 25.85 26.6 45 21.099999999999998 26.775 26.05 26.075 46 21.525 26.8 24.275 27.400000000000002 47 21.3 26.325 26.575 25.8 48 21.099999999999998 25.974999999999998 25.650000000000002 27.275 49 21.175 26.375 26.424999999999997 26.025 50 21.125 26.85 24.5 27.525 51 20.9 26.1 25.224999999999998 27.775 52 21.45 28.775000000000002 24.175 25.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 27.0 1 19.0 2 11.0 3 8.5 4 6.0 5 5.0 6 4.0 7 2.5 8 1.0 9 2.0 10 3.0 11 4.0 12 5.0 13 3.0 14 0.5 15 0.0 16 2.0 17 4.0 18 3.0 19 2.0 20 8.0 21 14.0 22 11.0 23 8.0 24 11.0 25 14.0 26 25.0 27 36.0 28 36.5 29 37.0 30 48.5 31 60.0 32 76.0 33 92.0 34 109.5 35 127.0 36 143.5 37 160.0 38 184.5 39 207.0 40 205.0 41 219.0 42 233.0 43 253.0 44 273.0 45 276.0 46 279.0 47 287.0 48 295.0 49 294.5 50 294.0 51 306.5 52 319.0 53 301.0 54 283.0 55 249.0 56 215.0 57 220.0 58 225.0 59 205.5 60 186.0 61 155.0 62 124.0 63 104.0 64 73.5 65 63.0 66 46.0 67 29.0 68 29.5 69 30.0 70 23.0 71 16.0 72 13.0 73 10.0 74 6.5 75 3.0 76 4.0 77 5.0 78 3.5 79 2.0 80 2.0 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.4699683877766 91.55 2 2.634351949420443 5.0 3 0.6585879873551107 1.875 4 0.13171759747102213 0.5 5 0.052687038988408846 0.25 6 0.0 0.0 7 0.026343519494204423 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026343519494204423 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 26 0.65 No Hit AGCACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCA 7 0.17500000000000002 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra Read 200000 spots for SRR5423359.sra Written 200000 spots for SRR5423359.sra SRR ids: ['SRR5423359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00ash1r7 SRR5423359.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423359 file size 703967 SRR5423359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423359 SRR5423359_1.fastq Input file: SRR5423359_1.fastq trimmed: SRR5423359-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:34:38 2025 >> started Thu Feb 13 00:39:14 2025 >> done (276.047s) 4000000 reads processed; of these: 117 ( 0.00%) short reads filtered out after trimming by size control 2820 ( 0.07%) empty reads filtered out after trimming by size control 3997063 (99.93%) reads available; of these: 116764 ( 2.92%) trimmed reads available after processing 3880299 (97.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 9 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 6 0.00% 29 11 0.00% 30 19 0.00% 31 12 0.00% 32 27 0.00% 33 31 0.00% 34 47 0.00% 35 44 0.00% 36 56 0.00% 37 74 0.00% 38 82 0.00% 39 120 0.00% 40 137 0.00% 41 228 0.01% 42 262 0.01% 43 365 0.01% 44 512 0.01% 45 690 0.02% 46 1053 0.03% 47 1619 0.04% 48 2806 0.07% 49 5301 0.13% 50 14830 0.37% 51 88380 2.21% 52 3880299 97.08% 3997063 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=10.24 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=1.0 sequence=GGGAGACCTTAAGCCAGCACCCAT Started job on | Feb 13 00:41:44 Started mapping on | Feb 13 00:41:55 Finished on | Feb 13 00:52:09 Mapping speed, Million of reads per hour | 23.44 Number of input reads | 3997063 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3273015 Uniquely mapped reads % | 81.89% Average mapped length | 51.74 Number of splices: Total | 299191 Number of splices: Annotated (sjdb) | 293340 Number of splices: GT/AG | 291552 Number of splices: GC/AG | 5926 Number of splices: AT/AC | 429 Number of splices: Non-canonical | 1284 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430582 % of reads mapped to multiple loci | 10.77% Number of reads mapped to too many loci | 141484 % of reads mapped to too many loci | 3.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293466 293466 293466 N_multimapping 430582 430582 430582 N_noFeature 601139 3152456 712918 N_ambiguous 18086 126 9201 UnstrandedReadsAssigned:2653790 PositiveStrandReadsAssigned:120433 NegativeStrandReadsAssigned:2550896 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423359 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423359-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,063 reads, 2,842,338 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR5423359.ke.tsv 34699 SRR5423359.se.tsv 87100 total ==> SRR5423359.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 295 55.731 Potri.005G024800.1.v4.1 1035 936 25 9.68309 Potri.004G059700.1.v4.1 961 862 5 2.10287 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.8395 7.37301 Potri.016G087400.1.v4.1 270 171 19 40.2817 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 4.33136 Potri.012G127500.1.v4.1 977 878 134 55.3299 ==> SRR5423359.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423359 completed mapping pipeline successfully