Starting /dee2/code/volunteer_pipeline.sh SRR5423360 current disk space = 3050894417920 free memory = 1573909488 SRR5423360 SRAfilesize dffadcc21e88e8044b054e42f887e89b SRR5423360.sra SRR5423360.sra file validated SRR5423360 is single end SRR5423360 is conventional basespace SRR5423360 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92875 33.0 31.0 34.0 30.0 34.0 2 31.852 33.0 31.0 34.0 30.0 34.0 3 32.045 34.0 31.0 34.0 30.0 34.0 4 35.47325 37.0 35.0 37.0 33.0 37.0 5 35.51775 37.0 35.0 37.0 33.0 37.0 6 35.52975 37.0 35.0 37.0 33.0 37.0 7 35.576 37.0 35.0 37.0 33.0 37.0 8 35.51775 37.0 35.0 37.0 33.0 37.0 9 37.277 39.0 37.0 39.0 34.0 39.0 10 36.981 39.0 37.0 39.0 33.0 39.0 11 37.09875 39.0 37.0 39.0 33.0 39.0 12 37.12175 39.0 37.0 39.0 33.0 39.0 13 37.228 39.0 37.0 39.0 34.0 39.0 14 38.4105 40.0 38.0 41.0 33.0 41.0 15 38.38225 40.0 38.0 41.0 33.0 41.0 16 38.203 40.0 38.0 41.0 33.0 41.0 17 38.19625 40.0 38.0 41.0 33.0 41.0 18 38.086 40.0 37.0 41.0 33.0 41.0 19 38.1825 40.0 38.0 41.0 33.0 41.0 20 38.3855 40.0 38.0 41.0 34.0 41.0 21 38.17775 40.0 38.0 41.0 33.0 41.0 22 38.176 40.0 37.0 41.0 33.0 41.0 23 38.1175 40.0 37.0 41.0 33.0 41.0 24 38.26175 40.0 38.0 41.0 34.0 41.0 25 38.1535 40.0 37.0 41.0 33.0 41.0 26 37.70625 40.0 37.0 41.0 32.0 41.0 27 37.91575 40.0 37.0 41.0 33.0 41.0 28 37.77975 40.0 37.0 41.0 32.0 41.0 29 37.72525 40.0 37.0 41.0 32.0 41.0 30 37.47525 40.0 37.0 41.0 31.0 41.0 31 37.40725 40.0 37.0 41.0 31.0 41.0 32 37.58975 40.0 37.0 41.0 32.0 41.0 33 37.533 40.0 37.0 41.0 31.0 41.0 34 37.52275 40.0 37.0 41.0 31.0 41.0 35 37.62225 40.0 37.0 41.0 32.0 41.0 36 37.62025 40.0 37.0 41.0 32.0 41.0 37 37.6675 40.0 37.0 41.0 32.0 41.0 38 37.53675 40.0 37.0 41.0 32.0 41.0 39 37.38875 40.0 36.0 41.0 31.0 41.0 40 37.27725 39.0 36.0 41.0 31.0 41.0 41 37.314 39.0 36.0 41.0 31.0 41.0 42 37.2425 39.0 36.0 41.0 31.0 41.0 43 36.8855 39.0 35.0 41.0 31.0 41.0 44 37.07025 39.0 36.0 41.0 31.0 41.0 45 36.89525 39.0 35.0 41.0 30.0 41.0 46 36.63725 39.0 35.0 41.0 30.0 41.0 47 36.60125 39.0 35.0 40.0 30.0 41.0 48 36.60225 39.0 35.0 41.0 30.0 41.0 49 36.57475 39.0 35.0 41.0 30.0 41.0 50 36.54275 39.0 35.0 40.0 30.0 41.0 51 36.4295 39.0 35.0 40.0 29.0 41.0 52 35.15375 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10 0.0 2309 11 0.0 2309 12 0.0 2309 13 0.0 2309 14 0.0 2309 15 0.0 2309 16 0.0 2309 17 0.0 2309 18 0.0 2309 19 0.0 2309 20 0.0 2309 21 0.0 2309 22 0.0 2309 23 0.0 2309 24 0.0 2309 25 0.0 2309 26 0.0 2309 27 0.0 2309 28 0.0 2309 29 0.0 2309 30 0.0 2309 31 0.0 2309 32 0.0 2309 33 0.0 2309 34 0.0 2309 35 0.0 2309 36 0.0 2309 37 0.0 2309 38 0.0 2309 39 0.0 2309 40 0.0 2309 41 0.0 2309 42 0.0 2309 43 0.0 2309 44 0.0 2309 45 0.0 2309 46 0.0 2309 47 0.0 2309 48 0.0 2309 49 0.0 2309 50 0.0 2309 51 0.0 2309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 4.0 22 2.0 23 6.0 24 5.0 25 16.0 26 16.0 27 34.0 28 40.0 29 41.0 30 89.0 31 96.0 32 129.0 33 158.0 34 203.0 35 255.0 36 330.0 37 464.0 38 756.0 39 1348.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.25 12.55 6.45 39.75 2 20.474999999999998 15.6 34.050000000000004 29.875 3 19.275000000000002 18.675 25.8 36.25 4 22.675 26.75 22.575 28.000000000000004 5 23.925 32.225 22.675 21.175 6 20.125 35.4 22.95 21.525 7 15.85 23.400000000000002 41.75 19.0 8 17.525 24.2 30.45 27.825 9 18.75 22.6 33.900000000000006 24.75 10 19.025 36.25 25.3 19.425 11 22.075 28.475 21.8 27.650000000000002 12 20.45 25.775 26.575 27.200000000000003 13 19.45 28.299999999999997 28.425 23.825 14 20.95 29.475 25.575 24.0 15 21.9 27.400000000000002 25.1 25.6 16 21.25 27.525 24.95 26.275 17 21.375 27.1 25.724999999999998 25.8 18 21.25 27.474999999999998 25.45 25.825 19 21.425 25.85 26.05 26.674999999999997 20 21.575 26.525 27.200000000000003 24.7 21 21.4 26.325 25.074999999999996 27.200000000000003 22 21.525 27.425 25.7 25.35 23 20.974999999999998 27.35 25.25 26.424999999999997 24 21.475 26.3 25.8 26.424999999999997 25 22.525000000000002 25.95 25.3 26.224999999999998 26 20.075000000000003 27.250000000000004 26.325 26.35 27 19.975 26.325 26.724999999999998 26.974999999999998 28 22.375 26.025 26.3 25.3 29 22.725 25.95 26.775 24.55 30 22.5 25.474999999999998 26.025 26.0 31 20.1 27.150000000000002 26.75 26.0 32 21.85 27.675 25.25 25.224999999999998 33 22.675 28.050000000000004 24.474999999999998 24.8 34 22.575 27.650000000000002 24.6 25.174999999999997 35 20.925 26.575 25.974999999999998 26.525 36 20.95 26.474999999999998 25.224999999999998 27.35 37 21.15 26.05 26.05 26.75 38 20.95 28.075 25.525 25.45 39 21.45536384096024 26.70667666916729 24.756189047261813 27.081770442610654 40 20.505126281570394 27.131782945736433 26.881720430107524 25.481370342585645 41 22.3 26.1 24.9 26.700000000000003 42 22.075 26.200000000000003 26.8 24.925 43 22.425 27.700000000000003 24.85 25.025 44 21.85 25.8 26.575 25.775 45 22.025 26.450000000000003 24.95 26.575 46 21.05 26.174999999999997 26.025 26.75 47 22.455613903475868 26.231557889472366 25.406351587896975 25.906476619154787 48 22.0 26.200000000000003 25.474999999999998 26.325 49 21.73043260815204 26.581645411352838 24.20605151287822 27.481870467616904 50 20.674999999999997 25.95 25.1 28.275 51 21.305326331582897 25.6064016004001 25.206301575393848 27.881970492623154 52 22.85 27.200000000000003 23.825 26.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 20.0 1 13.0 2 6.0 3 8.0 4 10.0 5 7.5 6 5.0 7 3.5 8 2.0 9 2.5 10 3.0 11 2.5 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 4.0 19 7.0 20 9.0 21 11.0 22 13.0 23 15.0 24 15.5 25 16.0 26 21.5 27 27.0 28 40.0 29 53.0 30 59.5 31 66.0 32 78.0 33 90.0 34 106.5 35 123.0 36 141.0 37 159.0 38 178.5 39 199.0 40 200.0 41 235.0 42 270.0 43 264.5 44 259.0 45 264.5 46 270.0 47 271.5 48 273.0 49 281.0 50 289.0 51 294.0 52 299.0 53 295.5 54 292.0 55 261.5 56 231.0 57 214.5 58 198.0 59 187.5 60 177.0 61 162.0 62 147.0 63 117.5 64 76.5 65 65.0 66 53.5 67 42.0 68 34.5 69 27.0 70 25.0 71 23.0 72 17.5 73 12.0 74 9.5 75 7.0 76 6.5 77 6.0 78 5.5 79 5.0 80 3.5 81 2.0 82 2.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.0 49 0.025 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.413390010627 90.725 2 2.497343251859724 4.7 3 0.5579171094580234 1.575 4 0.18597236981934112 0.7000000000000001 5 0.1328374070138151 0.625 6 0.1328374070138151 0.75 7 0.026567481402763018 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.053134962805526036 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 20 0.5 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 10 0.25 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCAC 7 0.17500000000000002 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 6 0.15 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 6 0.15 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCAC 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCG 6 0.15 TruSeq Adapter, Index 12 (100% over 52bp) CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit CCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGG 5 0.125 No Hit CTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAG 5 0.125 No Hit CCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116367 spots for SRR5423360.sra Written 116367 spots for SRR5423360.sra Read 116379 spots for SRR5423360.sra Written 116379 spots for SRR5423360.sra SRR ids: ['SRR5423360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qxt6ktnv SRR5423360.sra spots: 2327352 blocks: [[1, 116367], [116368, 232734], [232735, 349101], [349102, 465468], [465469, 581835], [581836, 698202], [698203, 814569], [814570, 930936], [930937, 1047303], [1047304, 1163670], [1163671, 1280037], [1280038, 1396404], [1396405, 1512771], [1512772, 1629138], [1629139, 1745505], [1745506, 1861872], [1861873, 1978239], [1978240, 2094606], [2094607, 2210973], [2210974, 2327352]] SRR5423360 file size 409095 SRR5423360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423360 SRR5423360_1.fastq Input file: SRR5423360_1.fastq trimmed: SRR5423360-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:29:13 2025 >> started Thu Feb 13 00:34:05 2025 >> done (291.882s) 2327352 reads processed; of these: 66 ( 0.00%) short reads filtered out after trimming by size control 1473 ( 0.06%) empty reads filtered out after trimming by size control 2325813 (99.93%) reads available; of these: 52915 ( 2.28%) trimmed reads available after processing 2272898 (97.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 5 0.00% 34 7 0.00% 35 4 0.00% 36 15 0.00% 37 21 0.00% 38 24 0.00% 39 31 0.00% 40 35 0.00% 41 43 0.00% 42 56 0.00% 43 84 0.00% 44 122 0.01% 45 182 0.01% 46 282 0.01% 47 475 0.02% 48 865 0.04% 49 1916 0.08% 50 5982 0.26% 51 42736 1.84% 52 2272898 97.72% 2325813 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=20 prefix-density=1.02 prefix-fanout=1.0 sequence=GGAGACCTTAGACCAGCACCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=11.28 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=CCATCATCCAATCCACGAATGAAACCTGGCGAAAAAGAAGTTCACACTTTCTGGCGACGTCTTTCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTTCGCCT Started job on | Feb 13 00:42:03 Started mapping on | Feb 13 00:42:22 Finished on | Feb 13 01:12:46 Mapping speed, Million of reads per hour | 4.59 Number of input reads | 2325813 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 1902338 Uniquely mapped reads % | 81.79% Average mapped length | 51.75 Number of splices: Total | 173058 Number of splices: Annotated (sjdb) | 169734 Number of splices: GT/AG | 168718 Number of splices: GC/AG | 3289 Number of splices: AT/AC | 289 Number of splices: Non-canonical | 762 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253043 % of reads mapped to multiple loci | 10.88% Number of reads mapped to too many loci | 82316 % of reads mapped to too many loci | 3.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 170432 170432 170432 N_multimapping 253043 253043 253043 N_noFeature 352662 1833625 416125 N_ambiguous 10916 88 5591 UnstrandedReadsAssigned:1538760 PositiveStrandReadsAssigned:68625 NegativeStrandReadsAssigned:1480622 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423360 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423360-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,325,813 reads, 1,648,277 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR5423360.ke.tsv 34699 SRR5423360.se.tsv 87100 total ==> SRR5423360.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 184 59.9343 Potri.005G024800.1.v4.1 1035 936 10 6.67816 Potri.004G059700.1.v4.1 961 862 3 2.17544 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.4645 7.35507 Potri.016G087400.1.v4.1 270 171 13 47.5204 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8 2.98722 Potri.012G127500.1.v4.1 977 878 81 57.6665 ==> SRR5423360.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 26 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423360 completed mapping pipeline successfully