Starting /dee2/code/volunteer_pipeline.sh SRR5423361 current disk space = 3050888257536 free memory = 1573959116 SRR5423361 SRAfilesize 3ca85e2f582404f04043ab8e1f09b97f SRR5423361.sra SRR5423361.sra file validated SRR5423361 is single end SRR5423361 is conventional basespace SRR5423361 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.42775 34.0 31.0 34.0 28.0 34.0 2 31.534 34.0 31.0 34.0 27.0 34.0 3 32.37075 34.0 31.0 34.0 28.0 34.0 4 35.98875 37.0 35.0 37.0 35.0 37.0 5 36.01425 37.0 35.0 37.0 35.0 37.0 6 36.03975 37.0 35.0 37.0 35.0 37.0 7 36.05475 37.0 35.0 37.0 35.0 37.0 8 36.099 37.0 35.0 37.0 35.0 37.0 9 37.852 39.0 38.0 39.0 35.0 39.0 10 37.58675 39.0 38.0 39.0 35.0 39.0 11 37.7675 39.0 38.0 39.0 35.0 39.0 12 37.73425 39.0 38.0 39.0 35.0 39.0 13 37.693 39.0 38.0 39.0 35.0 39.0 14 39.115 40.0 39.0 41.0 36.0 41.0 15 39.09025 40.0 39.0 41.0 36.0 41.0 16 39.14025 40.0 39.0 41.0 36.0 41.0 17 38.9915 40.0 39.0 41.0 36.0 41.0 18 38.977 40.0 38.0 41.0 36.0 41.0 19 38.94775 40.0 39.0 41.0 35.0 41.0 20 38.82975 40.0 38.0 41.0 35.0 41.0 21 38.81275 40.0 38.0 41.0 35.0 41.0 22 38.838 40.0 39.0 41.0 35.0 41.0 23 38.7685 40.0 38.0 41.0 35.0 41.0 24 38.7925 40.0 38.0 41.0 35.0 41.0 25 38.74525 40.0 38.0 41.0 35.0 41.0 26 38.68975 40.0 38.0 41.0 35.0 41.0 27 38.51975 40.0 38.0 41.0 34.0 41.0 28 38.5275 40.0 38.0 41.0 34.0 41.0 29 38.52175 40.0 38.0 41.0 34.0 41.0 30 38.33425 40.0 38.0 41.0 34.0 41.0 31 38.21075 40.0 38.0 41.0 33.0 41.0 32 38.23975 40.0 38.0 41.0 33.0 41.0 33 38.20775 40.0 38.0 41.0 34.0 41.0 34 38.173 40.0 38.0 41.0 33.0 41.0 35 38.09925 40.0 38.0 41.0 33.0 41.0 36 38.0255 40.0 38.0 41.0 33.0 41.0 37 37.83425 40.0 38.0 41.0 33.0 41.0 38 37.83375 40.0 38.0 41.0 33.0 41.0 39 37.80025 40.0 37.0 41.0 33.0 41.0 40 37.63825 40.0 37.0 41.0 32.0 41.0 41 37.6845 40.0 37.0 41.0 32.0 41.0 42 37.36675 40.0 37.0 41.0 31.0 41.0 43 36.901 40.0 36.0 41.0 30.0 41.0 44 37.135 40.0 36.0 41.0 31.0 41.0 45 36.9955 40.0 36.0 41.0 30.0 41.0 46 36.77075 40.0 36.0 41.0 30.0 41.0 47 36.67925 39.0 36.0 41.0 30.0 41.0 48 36.6315 39.0 36.0 41.0 29.0 41.0 49 36.468 39.0 35.0 41.0 29.0 41.0 50 36.45275 39.0 35.0 41.0 29.0 41.0 51 36.425 39.0 35.0 41.0 29.0 41.0 52 34.45675 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 4.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 4.0 23 7.0 24 9.0 25 13.0 26 22.0 27 24.0 28 35.0 29 50.0 30 61.0 31 61.0 32 88.0 33 102.0 34 151.0 35 216.0 36 255.0 37 437.0 38 817.0 39 1634.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.07650862068966 12.015086206896552 5.441810344827586 39.466594827586206 2 20.775 13.775 36.1 29.349999999999998 3 18.675 18.7 26.0 36.625 4 24.0 25.724999999999998 22.85 27.425 5 24.099999999999998 32.1 22.55 21.25 6 21.075 34.150000000000006 21.875 22.900000000000002 7 15.275 25.624999999999996 40.075 19.025 8 16.0 23.825 30.5 29.675 9 18.375 21.6 33.125 26.900000000000002 10 19.85 37.225 24.15 18.775 11 22.975 29.15 22.125 25.75 12 22.475 25.275 26.8 25.45 13 20.75 27.700000000000003 26.424999999999997 25.124999999999996 14 21.375 26.275 27.525 24.825 15 21.224999999999998 26.275 26.875 25.624999999999996 16 21.55 27.250000000000004 25.424999999999997 25.775 17 21.8 25.974999999999998 26.5 25.724999999999998 18 21.224999999999998 26.950000000000003 24.425 27.400000000000002 19 22.15 28.4 24.725 24.725 20 22.125 27.075 25.474999999999998 25.324999999999996 21 20.724999999999998 26.900000000000002 26.924999999999997 25.45 22 20.724999999999998 27.650000000000002 25.724999999999998 25.900000000000002 23 22.05 25.374999999999996 25.55 27.025 24 21.125 27.35 25.1 26.424999999999997 25 21.349999999999998 25.775 25.525 27.35 26 21.25 24.95 26.575 27.224999999999998 27 21.825 26.200000000000003 24.9 27.075 28 22.0 26.724999999999998 26.325 24.95 29 20.375 27.575 25.474999999999998 26.575 30 21.325 27.200000000000003 26.400000000000002 25.074999999999996 31 22.375 26.724999999999998 24.7 26.200000000000003 32 21.325 27.325 25.7 25.650000000000002 33 21.925 26.575 25.775 25.724999999999998 34 21.6 27.175 26.174999999999997 25.05 35 21.475 25.724999999999998 26.0 26.8 36 21.825 26.974999999999998 23.75 27.450000000000003 37 20.875 27.05 25.474999999999998 26.6 38 21.275 26.275 27.500000000000004 24.95 39 22.0 25.525 25.6 26.875 40 20.849999999999998 27.200000000000003 24.9 27.05 41 22.075 25.900000000000002 25.2 26.825 42 22.025 25.5 26.275 26.200000000000003 43 22.875 26.3 25.275 25.55 44 22.8 25.674999999999997 24.325 27.200000000000003 45 21.725 26.025 26.650000000000002 25.6 46 21.05 27.075 24.9 26.974999999999998 47 23.875 24.825 25.474999999999998 25.825 48 23.474999999999998 26.674999999999997 23.925 25.924999999999997 49 22.400000000000002 27.575 24.25 25.775 50 22.2 25.525 25.25 27.025 51 21.575 25.95 24.675 27.800000000000004 52 22.25 25.924999999999997 24.55 27.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 8.0 2 3.0 3 3.0 4 3.0 5 3.0 6 3.0 7 3.5 8 4.0 9 3.5 10 3.0 11 2.5 12 2.0 13 2.5 14 2.0 15 1.0 16 2.0 17 3.0 18 4.5 19 6.0 20 5.5 21 5.0 22 7.5 23 10.0 24 13.5 25 17.0 26 19.5 27 22.0 28 29.5 29 37.0 30 57.0 31 77.0 32 84.5 33 92.0 34 110.0 35 128.0 36 138.5 37 149.0 38 173.5 39 204.0 40 210.0 41 225.0 42 240.0 43 257.5 44 275.0 45 272.5 46 270.0 47 276.5 48 283.0 49 289.0 50 295.0 51 300.5 52 306.0 53 316.0 54 326.0 55 287.0 56 248.0 57 208.5 58 169.0 59 183.0 60 197.0 61 162.0 62 127.0 63 109.5 64 78.0 65 64.0 66 54.5 67 45.0 68 35.0 69 25.0 70 20.5 71 16.0 72 12.5 73 9.0 74 7.0 75 5.0 76 5.5 77 6.0 78 5.0 79 4.0 80 4.5 81 5.0 82 2.5 83 0.0 84 1.0 85 2.0 86 1.5 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.199999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 96.49261603375527 91.475 2 2.5316455696202533 4.8 3 0.4746835443037975 1.35 4 0.26371308016877637 1.0 5 0.18459915611814345 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.026371308016877634 0.2 9 0.0 0.0 >10 0.026371308016877634 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit CCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATT 8 0.2 No Hit CTCCCCTCTAGGAGCCACGACACCCAGGTCTTCACTAGGATGCCTTGGCTCA 5 0.125 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCACCC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit CCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACTGG 5 0.125 No Hit GCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGGCCAGCAC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra Read 200000 spots for SRR5423361.sra Written 200000 spots for SRR5423361.sra SRR ids: ['SRR5423361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zhsc44iv SRR5423361.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423361 file size 703984 SRR5423361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423361 SRR5423361_1.fastq Input file: SRR5423361_1.fastq trimmed: SRR5423361-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 00:33:45 2025 >> started Thu Feb 13 00:34:59 2025 >> done (74.451s) 4000000 reads processed; of these: 153 ( 0.00%) short reads filtered out after trimming by size control 2750 ( 0.07%) empty reads filtered out after trimming by size control 3997097 (99.93%) reads available; of these: 97077 ( 2.43%) trimmed reads available after processing 3900020 (97.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 2 0.00% 20 12 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 10 0.00% 25 7 0.00% 26 10 0.00% 27 10 0.00% 28 7 0.00% 29 7 0.00% 30 19 0.00% 31 15 0.00% 32 26 0.00% 33 35 0.00% 34 45 0.00% 35 47 0.00% 36 67 0.00% 37 68 0.00% 38 85 0.00% 39 98 0.00% 40 141 0.00% 41 190 0.00% 42 256 0.01% 43 340 0.01% 44 368 0.01% 45 606 0.02% 46 854 0.02% 47 1292 0.03% 48 2160 0.05% 49 4321 0.11% 50 12105 0.30% 51 73858 1.85% 52 3900020 97.57% 3997097 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.0 sequence=CACTTGCAGCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=19.53 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=1.0 sequence=ATTTTGACGTACACTCTCCCACTTGGGGAGATGTTAGACAGGTGCACCCGCGTAGTGCAA Started job on | Feb 13 00:39:51 Started mapping on | Feb 13 00:40:10 Finished on | Feb 13 01:02:51 Mapping speed, Million of reads per hour | 10.57 Number of input reads | 3997097 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3275597 Uniquely mapped reads % | 81.95% Average mapped length | 51.76 Number of splices: Total | 299929 Number of splices: Annotated (sjdb) | 294307 Number of splices: GT/AG | 292311 Number of splices: GC/AG | 5864 Number of splices: AT/AC | 489 Number of splices: Non-canonical | 1265 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427757 % of reads mapped to multiple loci | 10.70% Number of reads mapped to too many loci | 144088 % of reads mapped to too many loci | 3.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293743 293743 293743 N_multimapping 427757 427757 427757 N_noFeature 602284 3152632 716477 N_ambiguous 18090 127 9209 UnstrandedReadsAssigned:2655223 PositiveStrandReadsAssigned:122838 NegativeStrandReadsAssigned:2549911 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423361 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423361-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,997,097 reads, 2,854,548 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR5423361.ke.tsv 34699 SRR5423361.se.tsv 87100 total ==> SRR5423361.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 282 52.9346 Potri.005G024800.1.v4.1 1035 936 28 10.7758 Potri.004G059700.1.v4.1 961 862 5 2.08943 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 63.3026 8.01785 Potri.016G087400.1.v4.1 270 171 12 25.2785 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.8864 3.20333 Potri.012G127500.1.v4.1 977 878 138 56.6175 ==> SRR5423361.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423361 completed mapping pipeline successfully