Starting /dee2/code/volunteer_pipeline.sh SRR5423362 current disk space = 3051046146048 free memory = 1567361428 SRR5423362 SRAfilesize 94b6d6ec6c536b41ea9cf4f7c7ae667a SRR5423362.sra SRR5423362.sra file validated SRR5423362 is single end SRR5423362 is conventional basespace SRR5423362 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.82225 34.0 31.0 34.0 25.0 34.0 2 31.20025 34.0 31.0 34.0 26.0 34.0 3 32.243 34.0 31.0 34.0 28.0 34.0 4 35.85375 37.0 35.0 37.0 35.0 37.0 5 35.958 37.0 35.0 37.0 35.0 37.0 6 36.0325 37.0 35.0 37.0 35.0 37.0 7 36.075 37.0 35.0 37.0 35.0 37.0 8 36.0555 37.0 35.0 37.0 35.0 37.0 9 37.832 39.0 38.0 39.0 35.0 39.0 10 37.76775 39.0 38.0 39.0 35.0 39.0 11 37.81925 39.0 38.0 39.0 35.0 39.0 12 37.8325 39.0 38.0 39.0 35.0 39.0 13 37.80775 39.0 38.0 39.0 35.0 39.0 14 39.264 41.0 39.0 41.0 36.0 41.0 15 39.147 40.0 39.0 41.0 36.0 41.0 16 39.14725 40.0 39.0 41.0 36.0 41.0 17 39.16875 40.0 39.0 41.0 36.0 41.0 18 39.097 40.0 39.0 41.0 36.0 41.0 19 39.091 40.0 39.0 41.0 36.0 41.0 20 39.02125 40.0 39.0 41.0 35.0 41.0 21 38.853 40.0 38.0 41.0 35.0 41.0 22 38.9025 40.0 38.0 41.0 35.0 41.0 23 38.78025 40.0 38.0 41.0 35.0 41.0 24 38.73825 40.0 38.0 41.0 34.0 41.0 25 38.69 40.0 38.0 41.0 35.0 41.0 26 38.61 40.0 38.0 41.0 34.0 41.0 27 38.462 40.0 38.0 41.0 34.0 41.0 28 38.2345 40.0 38.0 41.0 33.0 41.0 29 38.2985 40.0 38.0 41.0 34.0 41.0 30 38.31325 40.0 38.0 41.0 34.0 41.0 31 38.22825 40.0 38.0 41.0 34.0 41.0 32 37.99925 40.0 38.0 41.0 33.0 41.0 33 37.8585 40.0 38.0 41.0 33.0 41.0 34 37.8315 40.0 38.0 41.0 32.0 41.0 35 37.8355 40.0 38.0 41.0 33.0 41.0 36 37.6015 40.0 38.0 41.0 32.0 41.0 37 37.51225 40.0 38.0 41.0 31.0 41.0 38 37.4285 40.0 37.0 41.0 31.0 41.0 39 37.4145 40.0 37.0 41.0 31.0 41.0 40 37.4485 40.0 37.0 41.0 31.0 41.0 41 37.446 40.0 37.0 41.0 31.0 41.0 42 37.40725 40.0 37.0 41.0 31.0 41.0 43 37.05225 40.0 37.0 41.0 30.0 41.0 44 37.10125 40.0 37.0 41.0 30.0 41.0 45 36.9065 40.0 36.0 41.0 30.0 41.0 46 36.755 40.0 36.0 41.0 30.0 41.0 47 36.42725 40.0 36.0 41.0 28.0 41.0 48 36.4165 39.0 35.0 41.0 28.0 41.0 49 36.57075 40.0 36.0 41.0 29.0 41.0 50 36.428 39.0 36.0 41.0 28.0 41.0 51 36.316 39.0 35.0 41.0 28.0 41.0 52 34.129 38.0 32.0 40.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 7.0 22 9.0 23 9.0 24 18.0 25 17.0 26 31.0 27 23.0 28 32.0 29 39.0 30 59.0 31 63.0 32 101.0 33 124.0 34 144.0 35 202.0 36 305.0 37 435.0 38 785.0 39 1591.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.11311969323473 12.434949328950973 5.8887975897014515 44.563133388112846 2 22.425 14.875 35.575 27.125 3 22.425 17.45 23.925 36.199999999999996 4 25.45 24.575 22.15 27.825 5 23.125 31.05 23.400000000000002 22.425 6 19.125 32.675 24.925 23.275000000000002 7 14.649999999999999 23.5 41.425 20.424999999999997 8 18.125 22.7 31.474999999999998 27.700000000000003 9 16.925 22.675 33.15 27.250000000000004 10 17.875 37.475 25.15 19.5 11 20.974999999999998 29.625 22.5 26.900000000000002 12 21.65 24.45 26.974999999999998 26.924999999999997 13 19.425 27.474999999999998 27.425 25.674999999999997 14 20.075000000000003 27.825 26.625 25.474999999999998 15 19.725 27.825 25.4 27.05 16 20.525 26.424999999999997 26.55 26.5 17 20.925 27.400000000000002 25.275 26.400000000000002 18 20.25 28.050000000000004 25.3 26.400000000000002 19 20.849999999999998 27.625 26.400000000000002 25.124999999999996 20 20.4 25.775 27.575 26.25 21 20.375 26.375 25.6 27.650000000000002 22 20.875 27.900000000000002 25.025 26.200000000000003 23 21.125 27.575 25.25 26.05 24 20.825 26.200000000000003 26.55 26.424999999999997 25 21.45 27.075 25.2 26.275 26 22.25 25.85 25.650000000000002 26.25 27 21.525 27.1 26.875 24.5 28 21.075 26.0 27.250000000000004 25.674999999999997 29 20.45 28.075 25.8 25.674999999999997 30 20.275000000000002 26.650000000000002 27.05 26.025 31 21.425 26.650000000000002 27.175 24.75 32 21.425 27.35 25.674999999999997 25.55 33 21.175 27.775 26.075 24.975 34 21.75 27.900000000000002 24.5 25.85 35 20.05 26.275 27.3 26.375 36 20.474999999999998 26.1 26.3 27.125 37 21.975 25.974999999999998 25.775 26.275 38 21.175 26.875 25.124999999999996 26.825 39 20.875 25.275 26.150000000000002 27.700000000000003 40 20.175 26.75 27.075 26.0 41 22.1 25.974999999999998 25.4 26.525 42 21.7 25.650000000000002 25.15 27.500000000000004 43 20.95 27.900000000000002 25.5 25.650000000000002 44 21.975 26.1 26.05 25.874999999999996 45 21.8 25.75 24.975 27.474999999999998 46 22.775000000000002 26.075 25.1 26.05 47 22.675 25.8 25.174999999999997 26.35 48 21.5 27.075 24.175 27.250000000000004 49 21.625 26.974999999999998 24.925 26.474999999999998 50 22.75 26.55 24.099999999999998 26.6 51 21.625 26.825 24.275 27.275 52 22.3 24.75 26.35 26.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 7.5 21 12.0 22 12.5 23 13.0 24 20.0 25 27.0 26 30.0 27 33.0 28 38.0 29 43.0 30 57.0 31 71.0 32 87.5 33 104.0 34 110.0 35 116.0 36 147.0 37 178.0 38 202.5 39 238.5 40 250.0 41 255.5 42 261.0 43 268.5 44 276.0 45 277.0 46 278.0 47 283.5 48 289.0 49 300.5 50 312.0 51 292.5 52 273.0 53 282.0 54 291.0 55 261.0 56 231.0 57 206.0 58 181.0 59 168.0 60 155.0 61 142.0 62 129.0 63 103.0 64 63.0 65 49.0 66 40.0 67 31.0 68 25.0 69 19.0 70 16.5 71 14.0 72 18.0 73 22.0 74 16.5 75 11.0 76 7.5 77 4.0 78 4.0 79 4.0 80 5.0 81 6.0 82 4.0 83 2.0 84 1.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.53118503118503 93.825 2 1.7151767151767152 3.3000000000000003 3 0.4677754677754678 1.35 4 0.10395010395010396 0.4 5 0.07796257796257797 0.375 6 0.07796257796257797 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02598752598752599 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 12 0.3 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra Read 200000 spots for SRR5423362.sra Written 200000 spots for SRR5423362.sra SRR ids: ['SRR5423362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7kegp9b SRR5423362.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423362 file size 703973 SRR5423362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423362 SRR5423362_1.fastq Input file: SRR5423362_1.fastq trimmed: SRR5423362-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 01:03:23 2025 >> started Thu Feb 13 01:08:34 2025 >> done (310.908s) 4000000 reads processed; of these: 81 ( 0.00%) short reads filtered out after trimming by size control 89 ( 0.00%) empty reads filtered out after trimming by size control 3999830 (100.00%) reads available; of these: 123868 ( 3.10%) trimmed reads available after processing 3875962 (96.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 15 0.00% 26 10 0.00% 27 19 0.00% 28 20 0.00% 29 30 0.00% 30 35 0.00% 31 40 0.00% 32 52 0.00% 33 49 0.00% 34 75 0.00% 35 55 0.00% 36 91 0.00% 37 111 0.00% 38 127 0.00% 39 153 0.00% 40 140 0.00% 41 209 0.01% 42 260 0.01% 43 376 0.01% 44 501 0.01% 45 740 0.02% 46 1014 0.03% 47 1748 0.04% 48 3048 0.08% 49 6156 0.15% 50 15734 0.39% 51 93039 2.33% 52 3875962 96.90% 3999830 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=17.15 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.5 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGAC Started job on | Feb 13 01:12:47 Started mapping on | Feb 13 01:12:47 Finished on | Feb 13 01:12:55 Mapping speed, Million of reads per hour | 1799.92 Number of input reads | 3999830 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3200777 Uniquely mapped reads % | 80.02% Average mapped length | 51.76 Number of splices: Total | 297819 Number of splices: Annotated (sjdb) | 291020 Number of splices: GT/AG | 290511 Number of splices: GC/AG | 5219 Number of splices: AT/AC | 723 Number of splices: Non-canonical | 1366 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410194 % of reads mapped to multiple loci | 10.26% Number of reads mapped to too many loci | 274716 % of reads mapped to too many loci | 6.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388859 388859 388859 N_multimapping 410194 410194 410194 N_noFeature 540392 3127067 605338 N_ambiguous 17841 124 8967 UnstrandedReadsAssigned:2642544 PositiveStrandReadsAssigned:73586 NegativeStrandReadsAssigned:2586472 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423362 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423362-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,830 reads, 3,038,910 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR5423362.ke.tsv 34699 SRR5423362.se.tsv 87100 total ==> SRR5423362.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 319 59.8353 Potri.005G024800.1.v4.1 1035 936 32 12.306 Potri.004G059700.1.v4.1 961 862 2 0.835149 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.6228 8.81177 Potri.016G087400.1.v4.1 270 171 16 33.6795 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 9 1.93521 Potri.012G127500.1.v4.1 977 878 108 44.2762 ==> SRR5423362.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 38 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR5423362 completed mapping pipeline successfully